Incidental Mutation 'R4154:Cptp'
ID315038
Institutional Source Beutler Lab
Gene Symbol Cptp
Ensembl Gene ENSMUSG00000029073
Gene Nameceramide-1-phosphate transfer protein
SynonymsGltpd1
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R4154 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155864723-155869440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155867200 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 12 (V12A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030901] [ENSMUST00000030949] [ENSMUST00000030950] [ENSMUST00000120794] [ENSMUST00000151961] [ENSMUST00000156460]
Predicted Effect probably benign
Transcript: ENSMUST00000030901
SMART Domains Protein: ENSMUSP00000030901
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
Lactamase_B 16 233 3.38e-17 SMART
Beta-Casp 245 363 6.94e-37 SMART
Pfam:RMMBL 376 418 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030949
SMART Domains Protein: ENSMUSP00000030949
Gene: ENSMUSG00000029072

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 72 469 2e-79 PFAM
Pfam:NCD3G 500 552 1.9e-16 PFAM
Pfam:7tm_3 576 821 9.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030950
AA Change: V12A

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030950
Gene: ENSMUSG00000029073
AA Change: V12A

DomainStartEndE-ValueType
Pfam:GLTP 27 179 1.4e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105586
AA Change: V12A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101211
Gene: ENSMUSG00000029073
AA Change: V12A

DomainStartEndE-ValueType
PDB:4KBR|H 1 35 3e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000120794
SMART Domains Protein: ENSMUSP00000112656
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
Lactamase_B 16 211 6.42e-9 SMART
Beta-Casp 223 341 6.94e-37 SMART
Pfam:RMMBL 354 396 3.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149458
Predicted Effect probably benign
Transcript: ENSMUST00000151961
AA Change: V12A

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115935
Gene: ENSMUSG00000029073
AA Change: V12A

DomainStartEndE-ValueType
Pfam:GLTP 25 181 1.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156266
Predicted Effect probably benign
Transcript: ENSMUST00000156460
SMART Domains Protein: ENSMUSP00000118803
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
SCOP:d1smla_ 1 66 7e-7 SMART
PDB:2I7V|A 3 38 1e-9 PDB
Blast:Lactamase_B 16 66 4e-30 BLAST
Meta Mutation Damage Score 0.1210 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Bicdl2 A G 17: 23,666,092 probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Cptp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1921:Cptp UTSW 4 155866538 missense probably damaging 1.00
R2279:Cptp UTSW 4 155866421 missense probably damaging 0.98
R3025:Cptp UTSW 4 155867221 missense possibly damaging 0.82
R6194:Cptp UTSW 4 155866641 missense probably damaging 1.00
R7455:Cptp UTSW 4 155866500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGTCTGCTAGCTGCTCCC -3'
(R):5'- ACTCAGGTGAAGGGATAGAACTTC -3'

Sequencing Primer
(F):5'- CATCCTCCTATGCCATGCGGG -3'
(R):5'- GAACTTCACCGTGATTCTCAGGAG -3'
Posted On2015-05-14