Incidental Mutation 'R4154:Shroom3'
ID 315039
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Name shroom family member 3
Synonyms D5Ertd287e, Shrm3, Shrm
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4154 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 92683435-92965318 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 92943086 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 1151 (V1151F)
Ref Sequence ENSEMBL: ENSMUSP00000153516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000113051
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1057F

low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113054
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1057F

low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113055
AA Change: V1232F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1232F

PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168878
AA Change: V1101F
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1101F

PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172706
SMART Domains Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201800
Predicted Effect probably damaging
Transcript: ENSMUST00000225438
AA Change: V1151F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Bicdl2 A G 17: 23,666,092 probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 92951065 missense probably damaging 1.00
IGL01086:Shroom3 APN 5 92948452 missense probably benign 0.01
IGL01363:Shroom3 APN 5 92940993 missense probably benign 0.01
IGL01468:Shroom3 APN 5 92940342 missense probably damaging 1.00
IGL01675:Shroom3 APN 5 92941680 missense probably damaging 0.99
IGL01862:Shroom3 APN 5 92962289 missense probably damaging 1.00
IGL01987:Shroom3 APN 5 92942189 missense probably damaging 0.99
IGL02104:Shroom3 APN 5 92940389 missense probably benign 0.32
IGL03248:Shroom3 APN 5 92952540 missense probably benign 0.00
IGL03386:Shroom3 APN 5 92948483 splice site probably benign
R0167:Shroom3 UTSW 5 92948395 splice site probably benign
R0388:Shroom3 UTSW 5 92951293 missense probably benign 0.39
R0395:Shroom3 UTSW 5 92780903 missense probably damaging 1.00
R0567:Shroom3 UTSW 5 92964453 missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 92942834 missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 92940656 missense probably damaging 0.97
R1845:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R1921:Shroom3 UTSW 5 92962365 critical splice donor site probably null
R2059:Shroom3 UTSW 5 92683784 missense probably damaging 1.00
R2203:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2204:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2205:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2301:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2344:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2345:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2346:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2348:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92780870 missense probably damaging 1.00
R2435:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2829:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2830:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2831:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2897:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2898:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3079:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3080:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3433:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3729:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3730:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3735:Shroom3 UTSW 5 92964444 missense possibly damaging 0.84
R3736:Shroom3 UTSW 5 92964444 missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3852:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3943:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3969:Shroom3 UTSW 5 92940879 missense probably benign 0.05
R4008:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4009:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4012:Shroom3 UTSW 5 92948483 splice site probably benign
R4157:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4172:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4173:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4201:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4202:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4204:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4205:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4206:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4284:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4285:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4364:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4384:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4456:Shroom3 UTSW 5 92940999 missense probably benign 0.14
R4707:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4712:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4751:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4755:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4760:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4773:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4774:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4776:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4801:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4802:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4856:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4857:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4860:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4860:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4882:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4883:Shroom3 UTSW 5 92951134 missense probably benign 0.14
R4886:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R5262:Shroom3 UTSW 5 92964573 missense probably damaging 1.00
R5271:Shroom3 UTSW 5 92962248 missense probably damaging 1.00
R5719:Shroom3 UTSW 5 92943018 missense probably benign 0.04
R5726:Shroom3 UTSW 5 92943005 missense probably benign 0.00
R5993:Shroom3 UTSW 5 92940188 missense probably damaging 1.00
R6078:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6079:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6138:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6153:Shroom3 UTSW 5 92964408 missense probably damaging 0.99
R6493:Shroom3 UTSW 5 92941561 missense probably benign 0.03
R6495:Shroom3 UTSW 5 92942069 missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 92940758 missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 92940936 missense probably damaging 1.00
R6893:Shroom3 UTSW 5 92942204 missense probably damaging 0.97
R6912:Shroom3 UTSW 5 92943017 missense probably benign 0.02
R6924:Shroom3 UTSW 5 92964403 missense probably damaging 1.00
R7083:Shroom3 UTSW 5 92964525 missense probably damaging 1.00
R7197:Shroom3 UTSW 5 92942604 missense probably damaging 1.00
R7366:Shroom3 UTSW 5 92964606 nonsense probably null
R7712:Shroom3 UTSW 5 92950947 missense probably benign 0.01
R7725:Shroom3 UTSW 5 92941653 missense probably benign 0.19
R7728:Shroom3 UTSW 5 92683707 missense possibly damaging 0.73
R7774:Shroom3 UTSW 5 92950489 missense probably damaging 0.98
R7795:Shroom3 UTSW 5 92919649 missense probably damaging 0.99
R7821:Shroom3 UTSW 5 92940846 missense probably damaging 0.98
R7971:Shroom3 UTSW 5 92951074 missense probably damaging 1.00
R8276:Shroom3 UTSW 5 92940480 missense probably damaging 0.99
R8934:Shroom3 UTSW 5 92941725 missense probably damaging 1.00
R8938:Shroom3 UTSW 5 92943071 missense probably damaging 1.00
R9083:Shroom3 UTSW 5 92950674 missense probably damaging 0.97
R9108:Shroom3 UTSW 5 92940116 missense probably damaging 1.00
R9124:Shroom3 UTSW 5 92964542 missense probably benign 0.19
R9295:Shroom3 UTSW 5 92950619 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-05-14