Incidental Mutation 'R4154:Igkv12-44'
ID315040
Institutional Source Beutler Lab
Gene Symbol Igkv12-44
Ensembl Gene ENSMUSG00000096422
Gene Nameimmunoglobulin kappa variable 12-44
SynonymsGm16851
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R4154 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location69814631-69815100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69814655 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 108 (C108Y)
Ref Sequence ENSEMBL: ENSMUSP00000100168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103367]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103367
AA Change: C108Y

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100168
Gene: ENSMUSG00000096422
AA Change: C108Y

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
IGv 38 110 1.86e-21 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Bicdl2 A G 17: 23,666,092 probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Igkv12-44
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4238:Igkv12-44 UTSW 6 69814884 missense probably benign 0.14
R5771:Igkv12-44 UTSW 6 69815091 missense probably benign 0.04
R6116:Igkv12-44 UTSW 6 69814854 missense possibly damaging 0.48
R7471:Igkv12-44 UTSW 6 69814734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCACATTGACCTTTAAGCC -3'
(R):5'- CCTATCTGCATCTGTGGGAGAAAC -3'

Sequencing Primer
(F):5'- TTGACCTTTAAGCCCTGGCAAAG -3'
(R):5'- TCTGTGGGAGAAACTGTCACCATC -3'
Posted On2015-05-14