Incidental Mutation 'R4154:Clcn4'
ID315041
Institutional Source Beutler Lab
Gene Symbol Clcn4
Ensembl Gene ENSMUSG00000000605
Gene Namechloride channel, voltage-sensitive 4
SynonymsClc4-2, Clcn4-2
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4154 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location7282309-7300851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7294834 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 67 (N67D)
Ref Sequence ENSEMBL: ENSMUSP00000147627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000619] [ENSMUST00000209916] [ENSMUST00000210061] [ENSMUST00000210362] [ENSMUST00000210594] [ENSMUST00000211574]
Predicted Effect probably benign
Transcript: ENSMUST00000000619
AA Change: N139D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000000619
Gene: ENSMUSG00000000605
AA Change: N139D

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
Pfam:Voltage_CLC 149 552 2.7e-111 PFAM
CBS 596 646 1.07e-1 SMART
CBS 687 734 4.92e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176903
Predicted Effect probably benign
Transcript: ENSMUST00000209916
Predicted Effect probably benign
Transcript: ENSMUST00000210061
AA Change: N139D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210318
Predicted Effect probably benign
Transcript: ENSMUST00000210362
AA Change: N67D

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210444
Predicted Effect probably benign
Transcript: ENSMUST00000210594
AA Change: N79D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211551
Predicted Effect probably benign
Transcript: ENSMUST00000211574
Meta Mutation Damage Score 0.1598 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. Chloride channel 4 has an evolutionary conserved CpG island and is conserved in both mouse and hamster. This gene is mapped in close proximity to APXL (Apical protein Xenopus laevis-like) and OA1 (Ocular albinism type I), which are both located on the human X chromosome at band p22.3. The physiological role of chloride channel 4 remains unknown but may contribute to the pathogenesis of neuronal disorders. Alternate splicing results in two transcript variants that encode different proteins. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Bicdl2 A G 17: 23,666,092 probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Clcn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Clcn4 APN 7 7287673 missense probably damaging 0.99
IGL01090:Clcn4 APN 7 7294036 missense probably benign 0.01
IGL01650:Clcn4 APN 7 7284281 splice site probably benign
IGL02404:Clcn4 APN 7 7287858 missense probably benign 0.04
IGL02493:Clcn4 APN 7 7284244 missense probably damaging 1.00
IGL02556:Clcn4 APN 7 7296066 missense probably benign
IGL02661:Clcn4 APN 7 7291731 splice site probably null
IGL02816:Clcn4 APN 7 7295088 missense probably damaging 1.00
IGL02882:Clcn4 APN 7 7290465 missense probably damaging 1.00
IGL03205:Clcn4 APN 7 7290420 missense probably damaging 1.00
IGL03289:Clcn4 APN 7 7284258 missense probably damaging 1.00
R0183:Clcn4 UTSW 7 7295091 nonsense probably null
R0379:Clcn4 UTSW 7 7296792 missense probably damaging 0.99
R0555:Clcn4 UTSW 7 7290504 missense possibly damaging 0.65
R0890:Clcn4 UTSW 7 7288965 missense possibly damaging 0.89
R1463:Clcn4 UTSW 7 7296764 nonsense probably null
R1549:Clcn4 UTSW 7 7291682 missense probably damaging 1.00
R1563:Clcn4 UTSW 7 7293982 missense probably damaging 1.00
R1966:Clcn4 UTSW 7 7284185 makesense probably null
R2764:Clcn4 UTSW 7 7296799 missense possibly damaging 0.81
R2874:Clcn4 UTSW 7 7290521 missense probably benign 0.33
R4023:Clcn4 UTSW 7 7290428 missense probably damaging 1.00
R4024:Clcn4 UTSW 7 7290428 missense probably damaging 1.00
R4152:Clcn4 UTSW 7 7294834 missense probably benign 0.02
R4298:Clcn4 UTSW 7 7296738 missense possibly damaging 0.93
R4535:Clcn4 UTSW 7 7287814 missense probably benign 0.01
R4574:Clcn4 UTSW 7 7287805 missense probably benign 0.23
R4977:Clcn4 UTSW 7 7291437 missense probably benign 0.00
R5158:Clcn4 UTSW 7 7291619 missense possibly damaging 0.94
R5302:Clcn4 UTSW 7 7294051 missense possibly damaging 0.95
R5369:Clcn4 UTSW 7 7296033 missense probably benign 0.26
R5624:Clcn4 UTSW 7 7288944 missense probably benign 0.35
R5626:Clcn4 UTSW 7 7289018 missense probably damaging 1.00
R5723:Clcn4 UTSW 7 7291682 missense probably damaging 1.00
R6154:Clcn4 UTSW 7 7291482 missense probably benign 0.00
R6259:Clcn4 UTSW 7 7291530 missense possibly damaging 0.92
R6396:Clcn4 UTSW 7 7294025 missense probably damaging 1.00
R6783:Clcn4 UTSW 7 7299182 unclassified probably benign
R7320:Clcn4 UTSW 7 7291828 missense probably benign 0.19
R7562:Clcn4 UTSW 7 7295082 missense possibly damaging 0.92
R7586:Clcn4 UTSW 7 7293959 missense probably benign 0.00
R7752:Clcn4 UTSW 7 7293937 missense probably benign
R7860:Clcn4 UTSW 7 7293061 missense probably damaging 1.00
R7872:Clcn4 UTSW 7 7287781 missense probably benign
R7895:Clcn4 UTSW 7 7295168 missense probably benign 0.26
R8069:Clcn4 UTSW 7 7296759 missense probably damaging 0.99
R8083:Clcn4 UTSW 7 7291428 missense possibly damaging 0.69
X0019:Clcn4 UTSW 7 7291610 missense probably damaging 1.00
Z1177:Clcn4 UTSW 7 7293040 nonsense probably null
Z1177:Clcn4 UTSW 7 7294756 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACAGGGTTTGTCTACCAGGC -3'
(R):5'- CACTTTTGAGGACAGGGACAAG -3'

Sequencing Primer
(F):5'- ACAGGGTTTGTCTACCAGGCTTATG -3'
(R):5'- GTCAGAGCTTCTTCTGAGCCAG -3'
Posted On2015-05-14