Mutagenetix > Incidental Mutation

Incidental Mutation 'R4154:Tubgcp5'

315042

Institutional Source

Beutler Lab

Gene Symbol

Tubgcp5

Ensembl Gene

ENSMUSG00000033790

Gene Name

tubulin, gamma complex associated protein 5

Synonyms

B130010C12Rik, GCP5

MMRRC Submission

040998-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R4154 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55794154-55831677 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 55805329 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 258 (V258M)

Ref Sequence

ENSEMBL: ENSMUSP00000146111 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206191]

AlphaFold

Q8BKN5

Predicted Effect

probably benign
Transcript: ENSMUST00000032627
AA Change: V258M

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790
AA Change: V258M

Domain	Start	End	E-Value	Type
low complexity region	109	124	N/A	INTRINSIC
Pfam:Spc97_Spc98	273	942	1.2e-126	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205779

Predicted Effect

probably benign
Transcript: ENSMUST00000205796
AA Change: V258M

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

Predicted Effect

probably benign
Transcript: ENSMUST00000206191

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206660

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206789

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

98% (51/52)

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI593442	A	T	9: 52,677,904	H124Q	probably benign	Het
Asph	C	T	4: 9,639,250	W38*	probably null	Het
Bicdl2	A	G	17: 23,666,092		probably null	Het
Chd8	T	C	14: 52,207,211		probably benign	Het
Clcn4	T	C	7: 7,294,834	N67D	probably benign	Het
Cptp	A	G	4: 155,867,200	V12A	possibly damaging	Het
Crim1	A	G	17: 78,237,843	I145V	probably benign	Het
Ctsc	G	A	7: 88,299,547	M195I	probably benign	Het
Ddx41	G	A	13: 55,534,480	R205W	possibly damaging	Het
Fas	T	G	19: 34,318,828	I180S	possibly damaging	Het
Fsip2	A	C	2: 82,987,069	E4382A	possibly damaging	Het
Galnt5	T	G	2: 57,998,493	L35R	probably damaging	Het
Gfpt2	G	A	11: 49,835,778		probably null	Het
Gjd4	G	T	18: 9,280,811	S89*	probably null	Het
Gm14496	A	T	2: 181,995,079	H110L	probably benign	Het
Golm1	A	G	13: 59,642,353	V211A	probably benign	Het
Gsc2	TGCAGCAGCAGCAGCAG	TGCAGCAGCAGCAG	16: 17,914,802		probably benign	Het
Ighv1-72	A	T	12: 115,758,397	M7K	probably benign	Het
Igkv12-44	C	T	6: 69,814,655	C108Y	possibly damaging	Het
Lum	T	C	10: 97,568,953	S237P	probably damaging	Het
Macf1	T	C	4: 123,471,813	K3052E	probably damaging	Het
Mdn1	A	G	4: 32,707,475	E1588G	probably damaging	Het
Ndst3	T	C	3: 123,672,227	Y32C	probably damaging	Het
Nucb2	A	G	7: 116,527,667	T172A	probably benign	Het
Olfr690	T	C	7: 105,329,385	N269S	probably damaging	Het
Pard3	G	T	8: 127,474,396	R978L	probably damaging	Het
Pcdha4	A	G	18: 36,953,586		probably null	Het
Pgk2	A	G	17: 40,208,258	V93A	probably damaging	Het
Pik3c3	G	A	18: 30,311,283	M516I	probably benign	Het
Plxnb2	A	G	15: 89,159,642	F1336L	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sipa1l1	G	C	12: 82,425,214	G1323R	possibly damaging	Het
Sntg1	A	T	1: 8,583,345		probably null	Het
Spef2	T	C	15: 9,626,021	K1153R	probably benign	Het
Strn3	C	T	12: 51,627,131	V566M	probably damaging	Het
Svep1	A	G	4: 58,069,068	F2906S	possibly damaging	Het
Tbc1d8	C	T	1: 39,386,135	V545M	probably damaging	Het
Tmem131	T	C	1: 36,808,793		probably benign	Het
Tnfsf8	A	G	4: 63,834,358	S157P	probably benign	Het
Vat1l	G	C	8: 114,205,803	G30R	possibly damaging	Het
Vegfb	T	C	19: 6,986,078	Y106C	probably damaging	Het
Vmn2r100	AAAACAGGAGTATTGATTGGAAAC	AAAAC	17: 19,523,419		probably null	Het
Zc3h15	T	C	2: 83,658,569	V161A	probably benign	Het

Other mutations in Tubgcp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00969:Tubgcp5	APN	7	55806595	missense	possibly damaging	0.91
IGL01291:Tubgcp5	APN	7	55808529	missense	possibly damaging	0.83
IGL01343:Tubgcp5	APN	7	55796031	splice site	probably benign
IGL01597:Tubgcp5	APN	7	55806832	splice site	probably benign
IGL01688:Tubgcp5	APN	7	55815018	missense	possibly damaging	0.92
IGL01843:Tubgcp5	APN	7	55799473	missense	probably benign	0.02
IGL01950:Tubgcp5	APN	7	55806088	missense	possibly damaging	0.93
IGL01957:Tubgcp5	APN	7	55818757	missense	probably damaging	1.00
IGL02902:Tubgcp5	APN	7	55806607	nonsense	probably null
IGL03105:Tubgcp5	APN	7	55825581	missense	probably damaging	1.00
ANU05:Tubgcp5	UTSW	7	55808529	missense	possibly damaging	0.83
R0078:Tubgcp5	UTSW	7	55818895	missense	probably damaging	1.00
R0322:Tubgcp5	UTSW	7	55814978	missense	probably damaging	0.98
R0362:Tubgcp5	UTSW	7	55800684	missense	probably damaging	1.00
R0449:Tubgcp5	UTSW	7	55823567	missense	probably benign
R0488:Tubgcp5	UTSW	7	55829338	missense	probably damaging	0.96
R0853:Tubgcp5	UTSW	7	55814851	splice site	probably benign
R0885:Tubgcp5	UTSW	7	55806055	nonsense	probably null
R1483:Tubgcp5	UTSW	7	55825707	critical splice donor site	probably null
R1746:Tubgcp5	UTSW	7	55808537	missense	probably benign	0.05
R1766:Tubgcp5	UTSW	7	55815020	missense	probably benign	0.15
R2148:Tubgcp5	UTSW	7	55799511	missense	probably damaging	1.00
R2229:Tubgcp5	UTSW	7	55830881	missense	probably damaging	1.00
R3766:Tubgcp5	UTSW	7	55830866	missense	probably damaging	0.98
R4838:Tubgcp5	UTSW	7	55794185	unclassified	probably benign
R4948:Tubgcp5	UTSW	7	55806123	missense	probably benign	0.00
R5110:Tubgcp5	UTSW	7	55808637	missense	probably damaging	0.96
R5347:Tubgcp5	UTSW	7	55823685	missense	probably damaging	1.00
R5417:Tubgcp5	UTSW	7	55825661	missense	possibly damaging	0.90
R5574:Tubgcp5	UTSW	7	55805329	missense	probably benign	0.01
R5758:Tubgcp5	UTSW	7	55818895	missense	probably damaging	1.00
R5957:Tubgcp5	UTSW	7	55814962	missense	probably benign	0.03
R6014:Tubgcp5	UTSW	7	55823609	missense	probably benign
R6141:Tubgcp5	UTSW	7	55806778	missense	probably benign	0.30
R6289:Tubgcp5	UTSW	7	55795923	missense	probably benign	0.05
R6511:Tubgcp5	UTSW	7	55817392	nonsense	probably null
R6563:Tubgcp5	UTSW	7	55825661	missense	possibly damaging	0.90
R6574:Tubgcp5	UTSW	7	55823583	missense	probably benign
R6596:Tubgcp5	UTSW	7	55806634	missense	probably benign	0.38
R7016:Tubgcp5	UTSW	7	55794229	missense	possibly damaging	0.76
R7038:Tubgcp5	UTSW	7	55805366	missense	probably damaging	0.99
R7075:Tubgcp5	UTSW	7	55829407	missense	probably benign	0.04
R7083:Tubgcp5	UTSW	7	55800695	nonsense	probably null
R7213:Tubgcp5	UTSW	7	55806112	missense	probably damaging	0.97
R7284:Tubgcp5	UTSW	7	55823567	missense	probably benign
R7600:Tubgcp5	UTSW	7	55808513	missense	probably benign
R7813:Tubgcp5	UTSW	7	55800696	missense	possibly damaging	0.49
R7920:Tubgcp5	UTSW	7	55816562	missense	probably benign	0.00
R7948:Tubgcp5	UTSW	7	55794248	missense	probably benign	0.01
R8438:Tubgcp5	UTSW	7	55804615	missense	possibly damaging	0.67
R8499:Tubgcp5	UTSW	7	55804615	missense	possibly damaging	0.67
R9087:Tubgcp5	UTSW	7	55817358	missense	probably damaging	1.00
R9211:Tubgcp5	UTSW	7	55806583	missense	probably benign	0.05
R9269:Tubgcp5	UTSW	7	55795945	missense	possibly damaging	0.94
R9329:Tubgcp5	UTSW	7	55829433	critical splice donor site	probably null
R9355:Tubgcp5	UTSW	7	55817429	critical splice donor site	probably null
R9498:Tubgcp5	UTSW	7	55813485	missense	possibly damaging	0.46
R9687:Tubgcp5	UTSW	7	55825579	critical splice acceptor site	probably null
Z1088:Tubgcp5	UTSW	7	55815101	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTAATTGCTCTGAACATGCTTCAC -3'
(R):5'- AATTCATCCCTAAGGCCTGTTG -3'

Sequencing Primer
(F):5'- GCTCTGAACATGCTTCACTAAAAAG -3'
(R):5'- CTGTTGCTAGCCTCCAAGTAGAATG -3'

Posted On

2015-05-14