Incidental Mutation 'R4154:Olfr690'
ID315044
Institutional Source Beutler Lab
Gene Symbol Olfr690
Ensembl Gene ENSMUSG00000050266
Gene Nameolfactory receptor 690
SynonymsGA_x6K02T2PBJ9-7959171-7958224, MOR31-2
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4154 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105328225-105334104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105329385 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 269 (N269S)
Ref Sequence ENSEMBL: ENSMUSP00000150831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061920] [ENSMUST00000211006] [ENSMUST00000216230]
Predicted Effect probably damaging
Transcript: ENSMUST00000061920
AA Change: N269S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061272
Gene: ENSMUSG00000050266
AA Change: N269S

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:7tm_4 33 312 2e-110 PFAM
Pfam:7TM_GPCR_Srsx 37 264 1.4e-9 PFAM
Pfam:7tm_1 43 294 1.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209868
Predicted Effect probably damaging
Transcript: ENSMUST00000211006
AA Change: N269S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216230
AA Change: N269S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Bicdl2 A G 17: 23,666,092 probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Olfr690
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Olfr690 APN 7 105329382 missense possibly damaging 0.95
IGL01403:Olfr690 APN 7 105329398 missense probably benign 0.01
IGL01546:Olfr690 APN 7 105329692 missense probably damaging 1.00
IGL02936:Olfr690 APN 7 105330005 nonsense probably null
R0206:Olfr690 UTSW 7 105329883 missense possibly damaging 0.76
R0206:Olfr690 UTSW 7 105329883 missense possibly damaging 0.76
R1425:Olfr690 UTSW 7 105329715 missense probably damaging 1.00
R1911:Olfr690 UTSW 7 105329383 missense probably benign 0.11
R2126:Olfr690 UTSW 7 105329252 nonsense probably null
R2511:Olfr690 UTSW 7 105329610 missense probably damaging 1.00
R2919:Olfr690 UTSW 7 105329860 missense probably damaging 1.00
R3755:Olfr690 UTSW 7 105330151 missense probably damaging 1.00
R4152:Olfr690 UTSW 7 105329385 missense probably damaging 1.00
R4153:Olfr690 UTSW 7 105329385 missense probably damaging 1.00
R4247:Olfr690 UTSW 7 105330148 missense probably benign
R5015:Olfr690 UTSW 7 105329604 missense possibly damaging 0.61
R5143:Olfr690 UTSW 7 105329524 missense probably damaging 1.00
R5642:Olfr690 UTSW 7 105329565 missense probably damaging 1.00
R6747:Olfr690 UTSW 7 105330027 missense probably benign 0.00
R6961:Olfr690 UTSW 7 105329706 missense probably damaging 1.00
R7074:Olfr690 UTSW 7 105329268 missense probably benign 0.44
R8066:Olfr690 UTSW 7 105329554 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACTAAGACAGCTTTGTGAACTGTG -3'
(R):5'- CATCACTGTCAATATCTGGTATGGC -3'

Sequencing Primer
(F):5'- GTGAACTGTGACTGCTCTCAAGAC -3'
(R):5'- ATGGCTTCTCGGTGCCAATG -3'
Posted On2015-05-14