Incidental Mutation 'R4154:Lum'
ID315049
Institutional Source Beutler Lab
Gene Symbol Lum
Ensembl Gene ENSMUSG00000036446
Gene Namelumican
SynonymsLdc, SLRR2D
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R4154 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location97565128-97572703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97568953 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 237 (S237P)
Ref Sequence ENSEMBL: ENSMUSP00000040877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038160]
Predicted Effect probably damaging
Transcript: ENSMUST00000038160
AA Change: S237P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040877
Gene: ENSMUSG00000036446
AA Change: S237P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 36 70 1.02e-10 SMART
LRR 66 88 2.14e1 SMART
LRR 89 114 1.92e2 SMART
LRR 135 157 1.67e2 SMART
LRR 158 181 7.8e1 SMART
LRR_TYP 183 206 2.36e-2 SMART
LRR 207 227 6.41e1 SMART
LRR 228 253 6.59e1 SMART
LRR 254 275 4.45e1 SMART
LRR 303 328 3.18e2 SMART
Meta Mutation Damage Score 0.5353 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene have abnormally large and aberrantly contoured collagen fibrils forming a disorganized matrix in the tendon, skin, cornea and sclera, with consequent reductions in skin tensile strength and corneal clarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Bicdl2 A G 17: 23,666,092 probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Lum
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Lum APN 10 97568685 missense probably damaging 1.00
IGL01394:Lum APN 10 97568972 missense probably damaging 1.00
IGL02160:Lum APN 10 97568581 missense probably damaging 0.96
IGL02659:Lum APN 10 97568747 missense probably benign
PIT4305001:Lum UTSW 10 97568876 missense probably damaging 1.00
R0352:Lum UTSW 10 97568609 missense probably damaging 0.97
R0403:Lum UTSW 10 97572043 missense probably benign 0.05
R1446:Lum UTSW 10 97568390 missense possibly damaging 0.88
R2760:Lum UTSW 10 97568771 missense probably benign 0.16
R4492:Lum UTSW 10 97568438 missense probably damaging 1.00
R7601:Lum UTSW 10 97568306 missense probably damaging 1.00
R8058:Lum UTSW 10 97568563 missense probably benign 0.00
X0065:Lum UTSW 10 97568980 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCTCGGCTTCTCTGAAAGG -3'
(R):5'- TCCGTGTATGACTGAGATAGAATTCC -3'

Sequencing Primer
(F):5'- GGTCTCAAATCACTAGAGTACCTGG -3'
(R):5'- GAGATCAAGCTCGAGCAA -3'
Posted On2015-05-14