Incidental Mutation 'R4154:Gfpt2'
ID315050
Institutional Source Beutler Lab
Gene Symbol Gfpt2
Ensembl Gene ENSMUSG00000020363
Gene Nameglutamine fructose-6-phosphate transaminase 2
SynonymsGFAT2
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4154 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49794178-49838613 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 49835778 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020629]
Predicted Effect probably null
Transcript: ENSMUST00000020629
SMART Domains Protein: ENSMUSP00000020629
Gene: ENSMUSG00000020363

DomainStartEndE-ValueType
Pfam:GATase_6 72 212 1e-19 PFAM
Pfam:GATase_4 75 206 1.6e-7 PFAM
Pfam:GATase_7 90 209 8.2e-16 PFAM
Pfam:SIS 363 492 1.7e-38 PFAM
Pfam:SIS 534 665 1.2e-29 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Bicdl2 A G 17: 23,666,092 probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Gfpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Gfpt2 APN 11 49809123 missense probably benign 0.00
IGL01451:Gfpt2 APN 11 49807690 splice site probably benign
IGL01490:Gfpt2 APN 11 49827127 splice site probably benign
IGL01550:Gfpt2 APN 11 49824323 splice site probably null
IGL01552:Gfpt2 APN 11 49805005 nonsense probably null
IGL02349:Gfpt2 APN 11 49807703 missense probably benign 0.02
IGL02815:Gfpt2 APN 11 49823257 missense possibly damaging 0.89
R0525:Gfpt2 UTSW 11 49829775 missense probably benign 0.06
R0539:Gfpt2 UTSW 11 49832898 missense probably damaging 1.00
R1055:Gfpt2 UTSW 11 49827211 missense probably damaging 1.00
R1178:Gfpt2 UTSW 11 49823309 missense probably benign 0.42
R1340:Gfpt2 UTSW 11 49832861 missense probably damaging 1.00
R2372:Gfpt2 UTSW 11 49807715 missense probably benign 0.00
R4476:Gfpt2 UTSW 11 49824342 missense probably benign 0.17
R4679:Gfpt2 UTSW 11 49823737 missense probably benign 0.00
R4863:Gfpt2 UTSW 11 49810970 missense probably benign 0.06
R5113:Gfpt2 UTSW 11 49823799 missense probably damaging 1.00
R5509:Gfpt2 UTSW 11 49827146 missense possibly damaging 0.75
R5830:Gfpt2 UTSW 11 49809061 missense probably benign 0.03
R6435:Gfpt2 UTSW 11 49835651 missense probably benign 0.00
R7079:Gfpt2 UTSW 11 49837751 missense possibly damaging 0.77
R7135:Gfpt2 UTSW 11 49804955 missense probably damaging 1.00
R7261:Gfpt2 UTSW 11 49823251 missense possibly damaging 0.77
R7294:Gfpt2 UTSW 11 49818608 nonsense probably null
R7384:Gfpt2 UTSW 11 49810990 missense possibly damaging 0.56
R7778:Gfpt2 UTSW 11 49824441 missense probably damaging 1.00
R7806:Gfpt2 UTSW 11 49823315 missense probably benign
R7824:Gfpt2 UTSW 11 49824441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCGCCCAATCATACTGTG -3'
(R):5'- CGTTGCACCTAACACGTTCATAAAG -3'

Sequencing Primer
(F):5'- TGTGTTCCAAGGATGACACC -3'
(R):5'- CCCTGAGCCCATAACTATG -3'
Posted On2015-05-14