Incidental Mutation 'R4154:Golm1'
ID315055
Institutional Source Beutler Lab
Gene Symbol Golm1
Ensembl Gene ENSMUSG00000021556
Gene Namegolgi membrane protein 1
Synonyms2310001L02Rik, GP73, PSEC0257, D030064E01Rik, Golph2
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R4154 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location59634626-59675811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59642353 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 211 (V211A)
Ref Sequence ENSEMBL: ENSMUSP00000093410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022039] [ENSMUST00000095739]
Predicted Effect probably benign
Transcript: ENSMUST00000022039
AA Change: V211A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000022039
Gene: ENSMUSG00000021556
AA Change: V211A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 40 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095739
AA Change: V211A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000093410
Gene: ENSMUSG00000021556
AA Change: V211A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 40 144 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225333
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. Alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased premature lethality with kidney abnormalities and liver steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Bicdl2 A G 17: 23,666,092 probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Golm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Golm1 APN 13 59649656 missense probably damaging 0.99
IGL01327:Golm1 APN 13 59645144 missense possibly damaging 0.95
IGL02348:Golm1 APN 13 59638377 missense probably benign 0.00
R0047:Golm1 UTSW 13 59645100 missense probably benign 0.03
R0047:Golm1 UTSW 13 59645100 missense probably benign 0.03
R0458:Golm1 UTSW 13 59664364 missense probably damaging 0.98
R0989:Golm1 UTSW 13 59640183 missense probably benign 0.01
R1301:Golm1 UTSW 13 59638373 missense probably damaging 0.99
R1804:Golm1 UTSW 13 59642389 critical splice acceptor site probably null
R1905:Golm1 UTSW 13 59642251 missense probably benign 0.04
R1940:Golm1 UTSW 13 59642237 splice site probably benign
R2086:Golm1 UTSW 13 59645185 nonsense probably null
R2513:Golm1 UTSW 13 59642258 missense probably benign 0.01
R2887:Golm1 UTSW 13 59640230 missense probably benign 0.00
R3903:Golm1 UTSW 13 59638340 missense probably damaging 1.00
R5580:Golm1 UTSW 13 59642365 missense probably benign 0.03
R6193:Golm1 UTSW 13 59645158 missense probably benign 0.00
R6418:Golm1 UTSW 13 59665561 missense probably damaging 1.00
R6594:Golm1 UTSW 13 59664227 missense possibly damaging 0.79
R6604:Golm1 UTSW 13 59638383 missense probably damaging 1.00
R6967:Golm1 UTSW 13 59649576 small deletion probably benign
R6968:Golm1 UTSW 13 59649576 small deletion probably benign
R6991:Golm1 UTSW 13 59649576 small deletion probably benign
R6992:Golm1 UTSW 13 59649576 small deletion probably benign
R6993:Golm1 UTSW 13 59649576 small deletion probably benign
R6996:Golm1 UTSW 13 59642244 missense probably benign 0.00
R7576:Golm1 UTSW 13 59645106 missense probably benign 0.00
R7692:Golm1 UTSW 13 59640257 missense probably benign 0.08
R7863:Golm1 UTSW 13 59649569 missense probably damaging 1.00
R7948:Golm1 UTSW 13 59664197 critical splice donor site probably null
X0026:Golm1 UTSW 13 59638313 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCTTCTCTGCTGCATCC -3'
(R):5'- TTGGATGGTTACATTTTCCTCTGC -3'

Sequencing Primer
(F):5'- CAGCCACAATCAATTCTCAGTGTCTG -3'
(R):5'- TGTAGGACCTGGACTTACCCAC -3'
Posted On2015-05-14