Incidental Mutation 'R4154:Chd8'
ID315056
Institutional Source Beutler Lab
Gene Symbol Chd8
Ensembl Gene ENSMUSG00000053754
Gene Namechromodomain helicase DNA binding protein 8
SynonymsDuplin, 5830451P18Rik
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4154 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location52198151-52257780 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 52207211 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169] [ENSMUST00000227897]
Predicted Effect probably benign
Transcript: ENSMUST00000089752
SMART Domains Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147827
Predicted Effect probably benign
Transcript: ENSMUST00000149975
SMART Domains Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754

DomainStartEndE-ValueType
low complexity region 74 93 N/A INTRINSIC
Blast:DEXDc 112 235 9e-40 BLAST
low complexity region 239 250 N/A INTRINSIC
low complexity region 363 374 N/A INTRINSIC
low complexity region 430 445 N/A INTRINSIC
Blast:SANT 456 515 1e-29 BLAST
low complexity region 547 563 N/A INTRINSIC
low complexity region 723 767 N/A INTRINSIC
low complexity region 882 899 N/A INTRINSIC
BRK 972 1016 1.34e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180857
Predicted Effect probably benign
Transcript: ENSMUST00000200169
SMART Domains Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227448
Predicted Effect probably benign
Transcript: ENSMUST00000227897
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Bicdl2 A G 17: 23,666,092 probably null Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Chd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Chd8 APN 14 52226138 missense probably damaging 0.99
IGL00694:Chd8 APN 14 52217970 missense probably damaging 1.00
IGL01011:Chd8 APN 14 52231532 missense possibly damaging 0.86
IGL01022:Chd8 APN 14 52236993 missense probably benign
IGL01066:Chd8 APN 14 52217766 missense probably damaging 1.00
IGL01083:Chd8 APN 14 52221420 missense probably damaging 1.00
IGL01313:Chd8 APN 14 52210575 missense probably damaging 1.00
IGL01396:Chd8 APN 14 52204587 unclassified probably benign
IGL01476:Chd8 APN 14 52205490 missense probably benign 0.32
IGL01731:Chd8 APN 14 52212654 missense probably benign 0.12
IGL01895:Chd8 APN 14 52199094 missense probably benign 0.00
IGL02090:Chd8 APN 14 52227234 critical splice donor site probably null
IGL02344:Chd8 APN 14 52201650 missense probably damaging 1.00
IGL02573:Chd8 APN 14 52219734 missense possibly damaging 0.95
IGL02601:Chd8 APN 14 52214300 missense possibly damaging 0.94
IGL02617:Chd8 APN 14 52235191 missense probably benign 0.34
IGL02873:Chd8 APN 14 52222513 missense probably damaging 0.99
IGL02974:Chd8 APN 14 52201701 unclassified probably null
IGL03058:Chd8 APN 14 52218273 missense probably damaging 1.00
IGL03076:Chd8 APN 14 52226162 splice site probably benign
IGL03239:Chd8 APN 14 52227548 missense possibly damaging 0.92
PIT4431001:Chd8 UTSW 14 52218249 missense probably damaging 0.98
PIT4468001:Chd8 UTSW 14 52207996 missense probably benign
PIT4468001:Chd8 UTSW 14 52217881 missense possibly damaging 0.95
R0006:Chd8 UTSW 14 52235293 missense possibly damaging 0.51
R0006:Chd8 UTSW 14 52235293 missense possibly damaging 0.51
R0022:Chd8 UTSW 14 52232855 missense probably benign 0.00
R0115:Chd8 UTSW 14 52237206 missense probably benign 0.00
R0131:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0131:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0132:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0419:Chd8 UTSW 14 52204060 missense probably benign 0.24
R0440:Chd8 UTSW 14 52204826 missense possibly damaging 0.91
R0452:Chd8 UTSW 14 52214587 missense probably damaging 1.00
R0481:Chd8 UTSW 14 52237206 missense probably benign 0.00
R0624:Chd8 UTSW 14 52219757 missense possibly damaging 0.65
R0650:Chd8 UTSW 14 52202304 missense probably benign 0.09
R0691:Chd8 UTSW 14 52213433 missense probably damaging 0.96
R0790:Chd8 UTSW 14 52204025 missense probably benign 0.07
R0835:Chd8 UTSW 14 52204025 missense probably benign 0.07
R1180:Chd8 UTSW 14 52221108 missense probably damaging 1.00
R1411:Chd8 UTSW 14 52224646 missense probably benign
R1725:Chd8 UTSW 14 52232573 missense probably benign 0.08
R1838:Chd8 UTSW 14 52204883 missense probably benign 0.11
R1839:Chd8 UTSW 14 52204883 missense probably benign 0.11
R1968:Chd8 UTSW 14 52220993 missense probably damaging 0.98
R2020:Chd8 UTSW 14 52215241 missense probably damaging 1.00
R2024:Chd8 UTSW 14 52231493 missense probably benign 0.23
R2139:Chd8 UTSW 14 52236971 missense probably benign 0.32
R2163:Chd8 UTSW 14 52198818 missense possibly damaging 0.53
R2342:Chd8 UTSW 14 52205217 missense probably benign 0.25
R2844:Chd8 UTSW 14 52204495 missense possibly damaging 0.92
R3500:Chd8 UTSW 14 52205653 missense probably benign 0.00
R3861:Chd8 UTSW 14 52237121 missense probably benign 0.13
R4445:Chd8 UTSW 14 52204527 unclassified probably null
R4628:Chd8 UTSW 14 52206915 missense probably benign 0.03
R4779:Chd8 UTSW 14 52231506 missense probably damaging 1.00
R4783:Chd8 UTSW 14 52205368 missense probably damaging 1.00
R4784:Chd8 UTSW 14 52205368 missense probably damaging 1.00
R5001:Chd8 UTSW 14 52203915 missense probably benign 0.09
R5280:Chd8 UTSW 14 52205125 missense possibly damaging 0.68
R5331:Chd8 UTSW 14 52202114 intron probably benign
R5348:Chd8 UTSW 14 52232698 missense probably damaging 1.00
R5375:Chd8 UTSW 14 52204154 missense probably damaging 1.00
R5470:Chd8 UTSW 14 52212609 missense probably damaging 1.00
R5479:Chd8 UTSW 14 52215195 missense probably benign 0.15
R5488:Chd8 UTSW 14 52213048 intron probably benign
R5489:Chd8 UTSW 14 52213048 intron probably benign
R5499:Chd8 UTSW 14 52204431 critical splice donor site probably null
R5988:Chd8 UTSW 14 52217938 missense probably damaging 1.00
R6046:Chd8 UTSW 14 52221071 missense possibly damaging 0.60
R6125:Chd8 UTSW 14 52207034 missense probably benign 0.16
R6212:Chd8 UTSW 14 52201698 missense probably damaging 1.00
R6337:Chd8 UTSW 14 52204109 missense probably damaging 1.00
R6394:Chd8 UTSW 14 52202585 missense possibly damaging 0.66
R6576:Chd8 UTSW 14 52216076 missense probably damaging 1.00
R6590:Chd8 UTSW 14 52227237 missense possibly damaging 0.60
R6690:Chd8 UTSW 14 52227237 missense possibly damaging 0.60
R6786:Chd8 UTSW 14 52226668 missense probably benign 0.33
R6913:Chd8 UTSW 14 52214494 missense probably damaging 0.99
R7090:Chd8 UTSW 14 52215220 missense probably damaging 0.99
R7107:Chd8 UTSW 14 52212672 missense probably benign 0.07
R7138:Chd8 UTSW 14 52214498 missense possibly damaging 0.83
R7383:Chd8 UTSW 14 52215319 missense probably damaging 1.00
R7392:Chd8 UTSW 14 52232855 missense probably benign
R7471:Chd8 UTSW 14 52204112 missense probably benign
R7625:Chd8 UTSW 14 52237077 missense probably benign 0.04
R7790:Chd8 UTSW 14 52226082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGCTGTTGAGTTACCTG -3'
(R):5'- CACTGCTCAGGTTCTGCTTG -3'

Sequencing Primer
(F):5'- AGTTACCTGGGCTGTGGAAAG -3'
(R):5'- TATCCCTTGGTGCCCCAGAAG -3'
Posted On2015-05-14