Mutagenetix > Incidental Mutations

Incidental Mutation 'R4154:Chd8'

315056

Institutional Source

Beutler Lab

Gene Symbol

Chd8

Ensembl Gene

ENSMUSG00000053754

Gene Name

chromodomain helicase DNA binding protein 8

Synonyms

Duplin, 5830451P18Rik

MMRRC Submission

040998-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4154 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52198151-52257780 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 52207211 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154595 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169] [ENSMUST00000227897]

Predicted Effect

probably benign
Transcript: ENSMUST00000089752

SMART Domains

Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134329

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136528

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145404

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147309

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147827

Predicted Effect

probably benign
Transcript: ENSMUST00000149975

SMART Domains

Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754

Domain	Start	End	E-Value	Type
low complexity region	74	93	N/A	INTRINSIC
Blast:DEXDc	112	235	9e-40	BLAST
low complexity region	239	250	N/A	INTRINSIC
low complexity region	363	374	N/A	INTRINSIC
low complexity region	430	445	N/A	INTRINSIC
Blast:SANT	456	515	1e-29	BLAST
low complexity region	547	563	N/A	INTRINSIC
low complexity region	723	767	N/A	INTRINSIC
low complexity region	882	899	N/A	INTRINSIC
BRK	972	1016	1.34e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175303

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180857

Predicted Effect

probably benign
Transcript: ENSMUST00000200169

SMART Domains

Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226681

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227448

Predicted Effect

probably benign
Transcript: ENSMUST00000227897

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI593442	A	T	9: 52,677,904	H124Q	probably benign	Het
Asph	C	T	4: 9,639,250	W38*	probably null	Het
Bicdl2	A	G	17: 23,666,092		probably null	Het
Clcn4	T	C	7: 7,294,834	N67D	probably benign	Het
Cptp	A	G	4: 155,867,200	V12A	possibly damaging	Het
Crim1	A	G	17: 78,237,843	I145V	probably benign	Het
Ctsc	G	A	7: 88,299,547	M195I	probably benign	Het
Ddx41	G	A	13: 55,534,480	R205W	possibly damaging	Het
Fas	T	G	19: 34,318,828	I180S	possibly damaging	Het
Fsip2	A	C	2: 82,987,069	E4382A	possibly damaging	Het
Galnt5	T	G	2: 57,998,493	L35R	probably damaging	Het
Gfpt2	G	A	11: 49,835,778		probably null	Het
Gjd4	G	T	18: 9,280,811	S89*	probably null	Het
Gm14496	A	T	2: 181,995,079	H110L	probably benign	Het
Golm1	A	G	13: 59,642,353	V211A	probably benign	Het
Gsc2	TGCAGCAGCAGCAGCAG	TGCAGCAGCAGCAG	16: 17,914,802		probably benign	Het
Ighv1-72	A	T	12: 115,758,397	M7K	probably benign	Het
Igkv12-44	C	T	6: 69,814,655	C108Y	possibly damaging	Het
Lum	T	C	10: 97,568,953	S237P	probably damaging	Het
Macf1	T	C	4: 123,471,813	K3052E	probably damaging	Het
Mdn1	A	G	4: 32,707,475	E1588G	probably damaging	Het
Ndst3	T	C	3: 123,672,227	Y32C	probably damaging	Het
Nucb2	A	G	7: 116,527,667	T172A	probably benign	Het
Olfr690	T	C	7: 105,329,385	N269S	probably damaging	Het
Pard3	G	T	8: 127,474,396	R978L	probably damaging	Het
Pcdha4	A	G	18: 36,953,586		probably null	Het
Pgk2	A	G	17: 40,208,258	V93A	probably damaging	Het
Pik3c3	G	A	18: 30,311,283	M516I	probably benign	Het
Plxnb2	A	G	15: 89,159,642	F1336L	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Sipa1l1	G	C	12: 82,425,214	G1323R	possibly damaging	Het
Sntg1	A	T	1: 8,583,345		probably null	Het
Spef2	T	C	15: 9,626,021	K1153R	probably benign	Het
Strn3	C	T	12: 51,627,131	V566M	probably damaging	Het
Svep1	A	G	4: 58,069,068	F2906S	possibly damaging	Het
Tbc1d8	C	T	1: 39,386,135	V545M	probably damaging	Het
Tmem131	T	C	1: 36,808,793		probably benign	Het
Tnfsf8	A	G	4: 63,834,358	S157P	probably benign	Het
Tubgcp5	G	A	7: 55,805,329	V258M	probably benign	Het
Vat1l	G	C	8: 114,205,803	G30R	possibly damaging	Het
Vegfb	T	C	19: 6,986,078	Y106C	probably damaging	Het
Vmn2r100	AAAACAGGAGTATTGATTGGAAAC	AAAAC	17: 19,523,419		probably null	Het
Zc3h15	T	C	2: 83,658,569	V161A	probably benign	Het

Other mutations in Chd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Chd8	APN	14	52226138	missense	probably damaging	0.99
IGL00694:Chd8	APN	14	52217970	missense	probably damaging	1.00
IGL01011:Chd8	APN	14	52231532	missense	possibly damaging	0.86
IGL01022:Chd8	APN	14	52236993	missense	probably benign
IGL01066:Chd8	APN	14	52217766	missense	probably damaging	1.00
IGL01083:Chd8	APN	14	52221420	missense	probably damaging	1.00
IGL01313:Chd8	APN	14	52210575	missense	probably damaging	1.00
IGL01396:Chd8	APN	14	52204587	unclassified	probably benign
IGL01476:Chd8	APN	14	52205490	missense	probably benign	0.32
IGL01731:Chd8	APN	14	52212654	missense	probably benign	0.12
IGL01895:Chd8	APN	14	52199094	missense	probably benign	0.00
IGL02090:Chd8	APN	14	52227234	critical splice donor site	probably null
IGL02344:Chd8	APN	14	52201650	missense	probably damaging	1.00
IGL02573:Chd8	APN	14	52219734	missense	possibly damaging	0.95
IGL02601:Chd8	APN	14	52214300	missense	possibly damaging	0.94
IGL02617:Chd8	APN	14	52235191	missense	probably benign	0.34
IGL02873:Chd8	APN	14	52222513	missense	probably damaging	0.99
IGL02974:Chd8	APN	14	52201701	unclassified	probably null
IGL03058:Chd8	APN	14	52218273	missense	probably damaging	1.00
IGL03076:Chd8	APN	14	52226162	splice site	probably benign
IGL03239:Chd8	APN	14	52227548	missense	possibly damaging	0.92
PIT4431001:Chd8	UTSW	14	52218249	missense	probably damaging	0.98
PIT4468001:Chd8	UTSW	14	52207996	missense	probably benign
PIT4468001:Chd8	UTSW	14	52217881	missense	possibly damaging	0.95
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0022:Chd8	UTSW	14	52232855	missense	probably benign	0.00
R0115:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0132:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0419:Chd8	UTSW	14	52204060	missense	probably benign	0.24
R0440:Chd8	UTSW	14	52204826	missense	possibly damaging	0.91
R0452:Chd8	UTSW	14	52214587	missense	probably damaging	1.00
R0481:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0624:Chd8	UTSW	14	52219757	missense	possibly damaging	0.65
R0650:Chd8	UTSW	14	52202304	missense	probably benign	0.09
R0691:Chd8	UTSW	14	52213433	missense	probably damaging	0.96
R0790:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R0835:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R1180:Chd8	UTSW	14	52221108	missense	probably damaging	1.00
R1411:Chd8	UTSW	14	52224646	missense	probably benign
R1725:Chd8	UTSW	14	52232573	missense	probably benign	0.08
R1838:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1839:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1968:Chd8	UTSW	14	52220993	missense	probably damaging	0.98
R2020:Chd8	UTSW	14	52215241	missense	probably damaging	1.00
R2024:Chd8	UTSW	14	52231493	missense	probably benign	0.23
R2139:Chd8	UTSW	14	52236971	missense	probably benign	0.32
R2163:Chd8	UTSW	14	52198818	missense	possibly damaging	0.53
R2342:Chd8	UTSW	14	52205217	missense	probably benign	0.25
R2844:Chd8	UTSW	14	52204495	missense	possibly damaging	0.92
R3500:Chd8	UTSW	14	52205653	missense	probably benign	0.00
R3861:Chd8	UTSW	14	52237121	missense	probably benign	0.13
R4445:Chd8	UTSW	14	52204527	unclassified	probably null
R4628:Chd8	UTSW	14	52206915	missense	probably benign	0.03
R4779:Chd8	UTSW	14	52231506	missense	probably damaging	1.00
R4783:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R4784:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R5001:Chd8	UTSW	14	52203915	missense	probably benign	0.09
R5280:Chd8	UTSW	14	52205125	missense	possibly damaging	0.68
R5331:Chd8	UTSW	14	52202114	intron	probably benign
R5348:Chd8	UTSW	14	52232698	missense	probably damaging	1.00
R5375:Chd8	UTSW	14	52204154	missense	probably damaging	1.00
R5470:Chd8	UTSW	14	52212609	missense	probably damaging	1.00
R5479:Chd8	UTSW	14	52215195	missense	probably benign	0.15
R5488:Chd8	UTSW	14	52213048	intron	probably benign
R5489:Chd8	UTSW	14	52213048	intron	probably benign
R5499:Chd8	UTSW	14	52204431	critical splice donor site	probably null
R5988:Chd8	UTSW	14	52217938	missense	probably damaging	1.00
R6046:Chd8	UTSW	14	52221071	missense	possibly damaging	0.60
R6125:Chd8	UTSW	14	52207034	missense	probably benign	0.16
R6212:Chd8	UTSW	14	52201698	missense	probably damaging	1.00
R6337:Chd8	UTSW	14	52204109	missense	probably damaging	1.00
R6394:Chd8	UTSW	14	52202585	missense	possibly damaging	0.66
R6576:Chd8	UTSW	14	52216076	missense	probably damaging	1.00
R6590:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6690:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6786:Chd8	UTSW	14	52226668	missense	probably benign	0.33
R6913:Chd8	UTSW	14	52214494	missense	probably damaging	0.99
R7090:Chd8	UTSW	14	52215220	missense	probably damaging	0.99
R7107:Chd8	UTSW	14	52212672	missense	probably benign	0.07
R7138:Chd8	UTSW	14	52214498	missense	possibly damaging	0.83
R7383:Chd8	UTSW	14	52215319	missense	probably damaging	1.00
R7392:Chd8	UTSW	14	52232855	missense	probably benign
R7471:Chd8	UTSW	14	52204112	missense	probably benign
R7625:Chd8	UTSW	14	52237077	missense	probably benign	0.04
R7790:Chd8	UTSW	14	52226082	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGGCTGTTGAGTTACCTG -3'
(R):5'- CACTGCTCAGGTTCTGCTTG -3'

Sequencing Primer
(F):5'- AGTTACCTGGGCTGTGGAAAG -3'
(R):5'- TATCCCTTGGTGCCCCAGAAG -3'

Posted On

2015-05-14