Incidental Mutation 'R4154:Gsc2'
ID315058
Institutional Source Beutler Lab
Gene Symbol Gsc2
Ensembl Gene ENSMUSG00000022738
Gene Namegoosecoid homebox 2
SynonymsGscl, 4930568H22Rik
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4154 (G1)
Quality Score144
Status Not validated
Chromosome16
Chromosomal Location17913107-17915059 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TGCAGCAGCAGCAGCAG to TGCAGCAGCAGCAG at 17914802 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003621] [ENSMUST00000012279] [ENSMUST00000232423] [ENSMUST00000232493]
Predicted Effect probably benign
Transcript: ENSMUST00000003621
SMART Domains Protein: ENSMUSP00000003621
Gene: ENSMUSG00000003527

DomainStartEndE-ValueType
low complexity region 7 34 N/A INTRINSIC
Pfam:Es2 37 405 1.9e-76 PFAM
low complexity region 434 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000012279
SMART Domains Protein: ENSMUSP00000012279
Gene: ENSMUSG00000022738

DomainStartEndE-ValueType
low complexity region 59 85 N/A INTRINSIC
low complexity region 95 119 N/A INTRINSIC
HOX 136 198 2.9e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232423
Predicted Effect probably benign
Transcript: ENSMUST00000232493
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Goosecoidlike (GSCL), a homeodomain-containing gene, resides in the critical region for VCFS/DGS on 22q11. Velocardiofacial syndrome (VCFS) is a developmental disorder characterized by conotruncal heart defects, craniofacial anomalies, and learning disabilities. VCFS is phenotypically related to DiGeorge syndrome (DGS) and both syndromes are associated with hemizygous 22q11 deletions. Because many of the tissues and structures affected in VCFS/DGS derive from the pharyngeal arches of the developing embryo, it is believed that haploinsufficiency of a gene involved in embryonic development may be responsible for its etiology. The gene is expressed in a limited number of adult tissues, as well as in early human development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either one of two independently generated knock-out alleles are viable and fertile with no detectable anatomical or histological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Bicdl2 A G 17: 23,666,092 probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Gsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3035:Gsc2 UTSW 16 17914928 missense probably damaging 0.99
R3153:Gsc2 UTSW 16 17914500 missense probably damaging 1.00
R3154:Gsc2 UTSW 16 17914500 missense probably damaging 1.00
R6182:Gsc2 UTSW 16 17913619 makesense probably null
R6962:Gsc2 UTSW 16 17915038 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCGCTGAAGATGGTACGGTG -3'
(R):5'- ATTAGCTCTCTGAGGACTGGCG -3'

Sequencing Primer
(F):5'- TGCTCTAGGCGCCGTCAAG -3'
(R):5'- ATTAGCACGCGCGAACG -3'
Posted On2015-05-14