Incidental Mutation 'R4154:Bicdl2'
ID315060
Institutional Source Beutler Lab
Gene Symbol Bicdl2
Ensembl Gene ENSMUSG00000043782
Gene NameBICD family like cargo adaptor 2
SynonymsCcdc64b
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4154 (G1)
Quality Score158
Status Validated
Chromosome17
Chromosomal Location23660523-23668610 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 23666092 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000053808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047436] [ENSMUST00000062967] [ENSMUST00000095579] [ENSMUST00000115489] [ENSMUST00000115490] [ENSMUST00000138190]
Predicted Effect probably benign
Transcript: ENSMUST00000047436
SMART Domains Protein: ENSMUSP00000038137
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 13 51 2e-18 BLAST
WD40 65 101 2.67e-1 SMART
Blast:WD40 119 154 1e-11 BLAST
WD40 157 196 1.28e-6 SMART
Blast:WD40 200 245 2e-25 BLAST
WD40 248 284 7.36e1 SMART
low complexity region 294 305 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000062967
SMART Domains Protein: ENSMUSP00000053808
Gene: ENSMUSG00000043782

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
coiled coil region 63 293 N/A INTRINSIC
low complexity region 304 312 N/A INTRINSIC
coiled coil region 354 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095579
SMART Domains Protein: ENSMUSP00000093239
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 13 51 2e-18 BLAST
WD40 65 101 2.67e-1 SMART
Blast:WD40 119 154 1e-11 BLAST
WD40 157 196 1.28e-6 SMART
Blast:WD40 200 245 2e-25 BLAST
WD40 248 284 7.36e1 SMART
low complexity region 294 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115489
SMART Domains Protein: ENSMUSP00000111152
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 11 47 6e-18 BLAST
WD40 61 97 2.67e-1 SMART
Blast:WD40 115 150 8e-12 BLAST
WD40 153 192 1.28e-6 SMART
Blast:WD40 196 241 3e-25 BLAST
WD40 244 280 7.36e1 SMART
low complexity region 290 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115490
SMART Domains Protein: ENSMUSP00000111153
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 13 51 7e-19 BLAST
WD40 65 101 2.67e-1 SMART
Blast:WD40 119 154 6e-12 BLAST
WD40 157 196 1.28e-6 SMART
Blast:WD40 200 245 8e-26 BLAST
Blast:WD40 248 279 4e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133849
Predicted Effect probably benign
Transcript: ENSMUST00000135259
SMART Domains Protein: ENSMUSP00000119920
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 32 67 9e-13 BLAST
WD40 70 109 1.28e-6 SMART
Blast:WD40 113 186 4e-20 BLAST
Blast:WD40 189 209 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138190
SMART Domains Protein: ENSMUSP00000123075
Gene: ENSMUSG00000041319

DomainStartEndE-ValueType
Blast:WD40 13 51 6e-20 BLAST
WD40 65 101 2.67e-1 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Bicdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Bicdl2 APN 17 23668131 missense probably damaging 1.00
IGL03283:Bicdl2 APN 17 23667181 missense probably damaging 1.00
R1013:Bicdl2 UTSW 17 23665403 unclassified probably benign
R1351:Bicdl2 UTSW 17 23667545 unclassified probably benign
R1512:Bicdl2 UTSW 17 23668109 missense probably damaging 0.96
R1768:Bicdl2 UTSW 17 23665949 missense probably damaging 1.00
R2886:Bicdl2 UTSW 17 23666758 unclassified probably null
R4440:Bicdl2 UTSW 17 23667616 missense probably benign 0.17
R5133:Bicdl2 UTSW 17 23661821 missense unknown
R5358:Bicdl2 UTSW 17 23667564 missense probably benign 0.00
R6759:Bicdl2 UTSW 17 23666744 splice site probably null
R7855:Bicdl2 UTSW 17 23666017 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTACAGGCAGAGGTGAGTAGC -3'
(R):5'- CAGACTTTTCTGTCCTGAGTTCTGG -3'

Sequencing Primer
(F):5'- AGGAGCTCCCTGAGACTG -3'
(R):5'- CCTGAGTTCTGGCCTTGGC -3'
Posted On2015-05-14