Incidental Mutation 'R4154:Crim1'
ID 315062
Institutional Source Beutler Lab
Gene Symbol Crim1
Ensembl Gene ENSMUSG00000024074
Gene Name cysteine rich transmembrane BMP regulator 1
Synonyms
MMRRC Submission 040998-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4154 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 78507677-78684021 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78545272 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 145 (I145V)
Ref Sequence ENSEMBL: ENSMUSP00000108117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112498]
AlphaFold Q9JLL0
Predicted Effect probably benign
Transcript: ENSMUST00000112498
AA Change: I145V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: I145V

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IB 35 111 1.87e-5 SMART
VWC 336 390 6.04e-13 SMART
VWC 403 456 1.15e-9 SMART
Pfam:Antistasin 469 498 4.5e-10 PFAM
Pfam:Antistasin 505 532 1.5e-8 PFAM
Pfam:Antistasin 539 564 5.7e-9 PFAM
Pfam:Antistasin 567 592 1.7e-10 PFAM
VWC 608 662 1.26e-10 SMART
VWC 679 734 1.37e-11 SMART
VWC 753 808 1.46e-11 SMART
VWC 819 873 1.01e-14 SMART
transmembrane domain 940 962 N/A INTRINSIC
Meta Mutation Damage Score 0.0580 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,589,204 (GRCm39) H124Q probably benign Het
Asph C T 4: 9,639,250 (GRCm39) W38* probably null Het
Bicdl2 A G 17: 23,885,066 (GRCm39) probably null Het
Chd8 T C 14: 52,444,668 (GRCm39) probably benign Het
Clcn4 T C 7: 7,297,833 (GRCm39) N67D probably benign Het
Cptp A G 4: 155,951,657 (GRCm39) V12A possibly damaging Het
Ctsc G A 7: 87,948,755 (GRCm39) M195I probably benign Het
Ddx41 G A 13: 55,682,293 (GRCm39) R205W possibly damaging Het
Fas T G 19: 34,296,228 (GRCm39) I180S possibly damaging Het
Fsip2 A C 2: 82,817,413 (GRCm39) E4382A possibly damaging Het
Galnt5 T G 2: 57,888,505 (GRCm39) L35R probably damaging Het
Gfpt2 G A 11: 49,726,605 (GRCm39) probably null Het
Gjd4 G T 18: 9,280,811 (GRCm39) S89* probably null Het
Gm14496 A T 2: 181,636,872 (GRCm39) H110L probably benign Het
Golm1 A G 13: 59,790,167 (GRCm39) V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,732,666 (GRCm39) probably benign Het
Ighv1-72 A T 12: 115,722,017 (GRCm39) M7K probably benign Het
Igkv12-44 C T 6: 69,791,639 (GRCm39) C108Y possibly damaging Het
Lum T C 10: 97,404,815 (GRCm39) S237P probably damaging Het
Macf1 T C 4: 123,365,606 (GRCm39) K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 (GRCm39) E1588G probably damaging Het
Ndst3 T C 3: 123,465,876 (GRCm39) Y32C probably damaging Het
Nucb2 A G 7: 116,126,902 (GRCm39) T172A probably benign Het
Or52b1 T C 7: 104,978,592 (GRCm39) N269S probably damaging Het
Pard3 G T 8: 128,200,877 (GRCm39) R978L probably damaging Het
Pcdha4 A G 18: 37,086,639 (GRCm39) probably null Het
Pgk2 A G 17: 40,519,149 (GRCm39) V93A probably damaging Het
Pik3c3 G A 18: 30,444,336 (GRCm39) M516I probably benign Het
Plxnb2 A G 15: 89,043,845 (GRCm39) F1336L probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sipa1l1 G C 12: 82,471,988 (GRCm39) G1323R possibly damaging Het
Sntg1 A T 1: 8,653,569 (GRCm39) probably null Het
Spef2 T C 15: 9,626,107 (GRCm39) K1153R probably benign Het
Strn3 C T 12: 51,673,914 (GRCm39) V566M probably damaging Het
Svep1 A G 4: 58,069,068 (GRCm39) F2906S possibly damaging Het
Tbc1d8 C T 1: 39,425,216 (GRCm39) V545M probably damaging Het
Tmem131 T C 1: 36,847,874 (GRCm39) probably benign Het
Tnfsf8 A G 4: 63,752,595 (GRCm39) S157P probably benign Het
Tubgcp5 G A 7: 55,455,077 (GRCm39) V258M probably benign Het
Vat1l G C 8: 114,932,543 (GRCm39) G30R possibly damaging Het
Vegfb T C 19: 6,963,446 (GRCm39) Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,743,681 (GRCm39) probably null Het
Zc3h15 T C 2: 83,488,913 (GRCm39) V161A probably benign Het
Other mutations in Crim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Crim1 APN 17 78,677,520 (GRCm39) missense probably damaging 1.00
IGL01090:Crim1 APN 17 78,654,658 (GRCm39) missense probably damaging 0.97
IGL01490:Crim1 APN 17 78,642,725 (GRCm39) missense possibly damaging 0.94
IGL01686:Crim1 APN 17 78,651,863 (GRCm39) missense probably benign 0.09
IGL01769:Crim1 APN 17 78,620,664 (GRCm39) missense probably benign 0.02
IGL02004:Crim1 APN 17 78,680,004 (GRCm39) splice site probably benign
IGL02211:Crim1 APN 17 78,662,574 (GRCm39) missense probably damaging 1.00
IGL02275:Crim1 APN 17 78,677,427 (GRCm39) missense possibly damaging 0.56
IGL02408:Crim1 APN 17 78,623,083 (GRCm39) missense possibly damaging 0.78
IGL02411:Crim1 APN 17 78,642,763 (GRCm39) nonsense probably null
IGL02453:Crim1 APN 17 78,651,913 (GRCm39) missense probably damaging 1.00
IGL02481:Crim1 APN 17 78,658,227 (GRCm39) missense probably damaging 0.98
IGL02632:Crim1 APN 17 78,680,103 (GRCm39) missense probably benign 0.08
IGL02652:Crim1 APN 17 78,623,106 (GRCm39) missense probably damaging 1.00
IGL02696:Crim1 APN 17 78,587,402 (GRCm39) missense probably damaging 0.96
IGL02811:Crim1 APN 17 78,658,130 (GRCm39) missense possibly damaging 0.62
IGL03105:Crim1 APN 17 78,623,179 (GRCm39) splice site probably benign
IGL03349:Crim1 APN 17 78,662,579 (GRCm39) nonsense probably null
bugeye UTSW 17 78,588,776 (GRCm39) missense possibly damaging 0.94
IGL03097:Crim1 UTSW 17 78,675,227 (GRCm39) missense probably benign 0.00
R0227:Crim1 UTSW 17 78,651,938 (GRCm39) splice site probably benign
R0458:Crim1 UTSW 17 78,620,655 (GRCm39) missense probably damaging 0.98
R0482:Crim1 UTSW 17 78,680,008 (GRCm39) missense probably benign 0.00
R0989:Crim1 UTSW 17 78,508,373 (GRCm39) missense probably benign 0.21
R1266:Crim1 UTSW 17 78,508,262 (GRCm39) small deletion probably benign
R1529:Crim1 UTSW 17 78,675,383 (GRCm39) missense probably benign
R1679:Crim1 UTSW 17 78,508,228 (GRCm39) missense probably benign 0.27
R1909:Crim1 UTSW 17 78,620,556 (GRCm39) missense probably benign 0.26
R2273:Crim1 UTSW 17 78,662,608 (GRCm39) critical splice donor site probably null
R3899:Crim1 UTSW 17 78,588,783 (GRCm39) missense probably benign 0.00
R3909:Crim1 UTSW 17 78,588,668 (GRCm39) splice site probably benign
R4092:Crim1 UTSW 17 78,658,265 (GRCm39) missense probably damaging 1.00
R4687:Crim1 UTSW 17 78,610,454 (GRCm39) missense probably damaging 1.00
R5022:Crim1 UTSW 17 78,587,558 (GRCm39) missense possibly damaging 0.95
R5073:Crim1 UTSW 17 78,588,776 (GRCm39) missense possibly damaging 0.94
R5089:Crim1 UTSW 17 78,681,519 (GRCm39) missense probably damaging 1.00
R5284:Crim1 UTSW 17 78,620,695 (GRCm39) missense possibly damaging 0.83
R5461:Crim1 UTSW 17 78,545,236 (GRCm39) missense probably damaging 1.00
R5635:Crim1 UTSW 17 78,623,070 (GRCm39) missense probably damaging 1.00
R5686:Crim1 UTSW 17 78,681,512 (GRCm39) missense possibly damaging 0.63
R5956:Crim1 UTSW 17 78,623,146 (GRCm39) missense probably damaging 1.00
R6117:Crim1 UTSW 17 78,610,517 (GRCm39) missense probably damaging 1.00
R6129:Crim1 UTSW 17 78,588,738 (GRCm39) missense probably benign 0.17
R6265:Crim1 UTSW 17 78,677,514 (GRCm39) missense probably benign 0.01
R6812:Crim1 UTSW 17 78,623,029 (GRCm39) missense probably damaging 1.00
R6858:Crim1 UTSW 17 78,623,056 (GRCm39) missense probably damaging 1.00
R7920:Crim1 UTSW 17 78,610,493 (GRCm39) missense probably damaging 1.00
R8022:Crim1 UTSW 17 78,622,984 (GRCm39) missense possibly damaging 0.82
R8434:Crim1 UTSW 17 78,654,686 (GRCm39) missense probably benign 0.00
R8782:Crim1 UTSW 17 78,508,306 (GRCm39) missense probably damaging 1.00
R8961:Crim1 UTSW 17 78,680,117 (GRCm39) missense possibly damaging 0.65
R8971:Crim1 UTSW 17 78,653,409 (GRCm39) missense possibly damaging 0.89
R9245:Crim1 UTSW 17 78,651,871 (GRCm39) missense probably damaging 1.00
R9250:Crim1 UTSW 17 78,677,471 (GRCm39) missense probably benign
R9401:Crim1 UTSW 17 78,658,294 (GRCm39) frame shift probably null
R9402:Crim1 UTSW 17 78,658,294 (GRCm39) frame shift probably null
R9644:Crim1 UTSW 17 78,587,497 (GRCm39) missense probably damaging 1.00
R9702:Crim1 UTSW 17 78,681,516 (GRCm39) missense probably damaging 1.00
R9710:Crim1 UTSW 17 78,610,504 (GRCm39) nonsense probably null
X0064:Crim1 UTSW 17 78,508,262 (GRCm39) small deletion probably benign
Z1088:Crim1 UTSW 17 78,675,264 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTCGCAAATGAAGGCCTCCC -3'
(R):5'- GGACTCTTCTAAGGTTGCCC -3'

Sequencing Primer
(F):5'- AATGAAGGCCTCCCATTTGG -3'
(R):5'- AGGTTGCCCTTGCCTTG -3'
Posted On 2015-05-14