Incidental Mutation 'R4154:Fas'
ID315067
Institutional Source Beutler Lab
Gene Symbol Fas
Ensembl Gene ENSMUSG00000024778
Gene NameFas (TNF receptor superfamily member 6)
SynonymsAPO-1, CD95, TNFR6, Tnfrsf6
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R4154 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34290659-34327770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 34318828 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 180 (I180S)
Ref Sequence ENSEMBL: ENSMUSP00000025691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025691]
PDB Structure
Structure of the FAS/FADD death domain assembly [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025691
AA Change: I180S

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025691
Gene: ENSMUSG00000024778
AA Change: I180S

DomainStartEndE-ValueType
TNFR 44 78 2.43e0 SMART
TNFR 81 123 3.21e-8 SMART
TNFR 125 161 9.45e-6 SMART
transmembrane domain 170 187 N/A INTRINSIC
DEATH 212 306 2.82e-22 SMART
Meta Mutation Damage Score 0.2078 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains a death domain. It has been shown to play a central role in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune system. The interaction of this receptor with its ligand allows the formation of a death-inducing signaling complex that includes Fas-associated death domain protein (FADD), caspase 8, and caspase 10. The autoproteolytic processing of the caspases in the complex triggers a downstream caspase cascade, and leads to apoptosis. This receptor has been also shown to activate NF-kappaB, MAPK3/ERK1, and MAPK8/JNK, and is found to be involved in transducing the proliferating signals in normal diploid fibroblast and T cells. Several alternatively spliced transcript variants have been described, some of which are candidates for nonsense-mediated mRNA decay (NMD). The isoforms lacking the transmembrane domain may negatively regulate the apoptosis mediated by the full length isoform. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mutations in this locus affect immune function and homozygotes show varying severity of lymphadenopathy, splenomegaly, lymphocytic infiltrations, elevated immunoglobulin levels, autoantibodies, impaired clonal deletion of T cells, and lupus-like disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Bicdl2 A G 17: 23,666,092 probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Pik3c3 G A 18: 30,311,283 M516I probably benign Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Fas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fas APN 19 34318618 missense probably damaging 1.00
IGL01677:Fas APN 19 34318818 missense probably benign 0.09
IGL01834:Fas APN 19 34318603 missense probably benign 0.33
IGL02130:Fas APN 19 34315295 missense probably benign 0.01
IGL02424:Fas APN 19 34327034 missense probably damaging 1.00
IGL02532:Fas APN 19 34316599 missense probably damaging 0.99
IGL02569:Fas APN 19 34320562 missense possibly damaging 0.93
bing UTSW 19 34316569 missense probably damaging 1.00
cherry UTSW 19 34327140 missense probably damaging 0.99
P0021:Fas UTSW 19 34307210 missense probably damaging 0.98
R0525:Fas UTSW 19 34319327 missense probably damaging 1.00
R0588:Fas UTSW 19 34327140 missense probably damaging 0.99
R1465:Fas UTSW 19 34316613 missense probably damaging 1.00
R1465:Fas UTSW 19 34316613 missense probably damaging 1.00
R2077:Fas UTSW 19 34320553 splice site probably benign
R2283:Fas UTSW 19 34307249 missense probably damaging 1.00
R5252:Fas UTSW 19 34316643 missense probably damaging 0.99
R5943:Fas UTSW 19 34320587 critical splice donor site probably null
R6474:Fas UTSW 19 34316569 missense probably damaging 1.00
R6837:Fas UTSW 19 34307164 missense probably damaging 0.97
R7640:Fas UTSW 19 34307164 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AACATGGAACCCTTGAGCCG -3'
(R):5'- CTTTGAAGGAAACACGTTGTCATAC -3'

Sequencing Primer
(F):5'- TTGAGCCGTGCACAGCAAC -3'
(R):5'- TTAAAGACACAAAATAAGGAGGAGTG -3'
Posted On2015-05-14