Mutagenetix > Incidental Mutation

Incidental Mutation 'R0389:Ints2'

31507

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

038595-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0389 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 86248851 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 306 (V306I)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039] [ENSMUST00000139285]

AlphaFold

Q80UK8

Predicted Effect

probably damaging
Transcript: ENSMUST00000018212
AA Change: V306I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: V306I

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108039
AA Change: V306I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: V306I

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134883

Predicted Effect

probably benign
Transcript: ENSMUST00000139285

SMART Domains

Protein: ENSMUSP00000119084
Gene: ENSMUSG00000018068

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	190	1.4e-69	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.9%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432M17Rik	G	A	3: 121,671,404	E30K	unknown	Het
Abi3bp	A	T	16: 56,671,307	T1319S	possibly damaging	Het
Adam18	T	C	8: 24,629,637		probably null	Het
Adgre1	G	A	17: 57,406,839	D175N	possibly damaging	Het
Adgrf1	T	C	17: 43,303,788		probably null	Het
Ankhd1	A	G	18: 36,644,599	S1612G	possibly damaging	Het
Anks1	A	G	17: 27,995,952	R458G	possibly damaging	Het
C130026I21Rik	T	A	1: 85,270,052	N5Y	probably benign	Het
Cacna1g	C	T	11: 94,459,697	V441M	probably damaging	Het
Cadps2	A	T	6: 23,321,782	V1037E	possibly damaging	Het
Casz1	T	C	4: 148,948,911	V1380A	possibly damaging	Het
Cenpq	T	C	17: 40,933,194		probably benign	Het
Chrac1	T	C	15: 73,093,527	I93T	possibly damaging	Het
Cntnap2	T	A	6: 46,009,637	S359T	probably benign	Het
Col6a6	C	A	9: 105,784,204	M235I	probably benign	Het
Crat	T	C	2: 30,403,628		probably benign	Het
Cyp1a2	T	C	9: 57,682,025	N169D	probably benign	Het
Dennd1c	T	A	17: 57,067,649	T499S	probably benign	Het
Dst	A	G	1: 34,294,550		probably null	Het
Dync2h1	G	T	9: 7,167,244		probably null	Het
Eif3h	C	A	15: 51,799,264	V129F	probably damaging	Het
Eno2	A	G	6: 124,762,691	F380L	probably damaging	Het
Ergic2	T	A	6: 148,183,202	I34F	probably benign	Het
Ergic3	G	A	2: 156,016,787	V278M	probably benign	Het
Fam185a	C	T	5: 21,459,285	T339M	probably damaging	Het
Fam20b	A	T	1: 156,681,453	D396E	probably benign	Het
Fam71f2	T	A	6: 29,281,392	V43E	possibly damaging	Het
Fasn	G	T	11: 120,816,182	D881E	probably damaging	Het
Fat1	C	A	8: 44,950,348	H45Q	probably benign	Het
Fbxw16	A	T	9: 109,432,482	C439S	probably benign	Het
Gba2	A	T	4: 43,570,832	F280Y	probably damaging	Het
Gfm1	A	G	3: 67,457,918	I517V	probably benign	Het
Gng13	C	T	17: 25,718,722	Q8*	probably null	Het
Golga1	A	T	2: 39,018,441	S749T	probably damaging	Het
Gphn	A	T	12: 78,590,659	I381F	probably damaging	Het
Grm3	T	C	5: 9,504,794	N833D	probably damaging	Het
Gstt2	G	T	10: 75,832,432	T163K	probably damaging	Het
Gusb	A	T	5: 129,998,086	V388E	probably damaging	Het
Hcrtr2	A	T	9: 76,246,380	Y243*	probably null	Het
Hspg2	A	G	4: 137,515,423	T650A	possibly damaging	Het
Itga1	T	A	13: 114,992,460	D554V	probably benign	Het
Itgam	C	T	7: 128,081,634	A245V	probably damaging	Het
Kcnk15	A	G	2: 163,858,323	T161A	probably benign	Het
Klhl18	A	T	9: 110,428,681	C564S	probably benign	Het
Krt40	T	A	11: 99,541,714	R159*	probably null	Het
L3mbtl4	G	A	17: 68,455,780	V103M	probably damaging	Het
Lnx2	C	A	5: 147,019,040	V649L	possibly damaging	Het
Lpp	A	T	16: 24,608,241	Q39H	probably damaging	Het
Lrpprc	A	T	17: 84,753,112		probably null	Het
Map3k19	A	T	1: 127,822,415	N1066K	probably benign	Het
Mbtps2	G	T	X: 157,568,368	T134K	probably benign	Het
Mfng	C	T	15: 78,764,437	V147M	possibly damaging	Het
Mks1	T	C	11: 87,857,928	S273P	probably benign	Het
Myh2	T	C	11: 67,180,821	L488P	probably damaging	Het
Myo15	A	G	11: 60,478,538	N708S	probably benign	Het
Myo6	A	T	9: 80,292,466	N1019I	probably damaging	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Ncoa1	T	G	12: 4,295,976	N457T	probably benign	Het
Neb	T	C	2: 52,161,477		probably null	Het
Nlrp4e	C	A	7: 23,355,203	N927K	probably damaging	Het
Npffr2	T	C	5: 89,582,754	M181T	probably benign	Het
Nxf7	A	T	X: 135,584,383	C495S	possibly damaging	Het
Oas1g	T	C	5: 120,887,529	T12A	probably benign	Het
Olfr130	C	G	17: 38,067,671	R167G	possibly damaging	Het
Olfr23	T	A	11: 73,941,053	V269E	probably benign	Het
Olfr484	A	G	7: 108,124,816	V149A	probably benign	Het
Olfr591	A	T	7: 103,173,283	V118E	possibly damaging	Het
Olfr744	T	A	14: 50,618,579	L119Q	probably damaging	Het
Papln	C	T	12: 83,783,379	Q1008*	probably null	Het
Pcdhb10	A	C	18: 37,412,432	D187A	probably damaging	Het
Phf2	T	A	13: 48,804,489	E1016D	unknown	Het
Phf8	T	A	X: 151,552,622	D197E	probably benign	Het
Pikfyve	A	G	1: 65,196,706	H179R	probably damaging	Het
Prkcz	T	A	4: 155,269,140	D250V	probably damaging	Het
Prpf4	A	G	4: 62,422,605	Y419C	probably damaging	Het
Prr15l	C	A	11: 96,934,614	Y23*	probably null	Het
Prr5	T	A	15: 84,702,951	S301T	probably benign	Het
Psg16	T	A	7: 17,095,163	I224N	probably benign	Het
Radil	A	G	5: 142,543,471	F186L	probably damaging	Het
Reg3g	A	T	6: 78,468,561	M1K	probably null	Het
Rps6ka3	A	G	X: 159,317,967	Y76C	probably damaging	Het
Rtl1	C	T	12: 109,590,363	V1681I	possibly damaging	Het
Sfmbt1	C	T	14: 30,811,507	R614C	probably damaging	Het
Slc12a4	A	G	8: 105,951,967	S244P	probably benign	Het
Sptbn1	T	C	11: 30,139,250	T671A	possibly damaging	Het
Supt16	A	T	14: 52,174,113	N604K	probably damaging	Het
Synj2	G	A	17: 6,029,783	V1096I	probably benign	Het
Tas2r129	G	T	6: 132,951,196	C32F	probably benign	Het
Tbc1d25	T	C	X: 8,172,869	Y140C	probably damaging	Het
Tdrd7	A	G	4: 46,016,987	D709G	probably benign	Het
Tfap2d	C	T	1: 19,104,367	R15C	possibly damaging	Het
Tgfbi	C	A	13: 56,629,702	T333N	probably benign	Het
Tnk1	T	C	11: 69,855,682	Y235C	probably damaging	Het
Ttc17	A	G	2: 94,378,094	F144S	probably benign	Het
Twnk	G	T	19: 45,008,139	G337V	possibly damaging	Het
Unc13a	A	G	8: 71,658,032	F464L	probably benign	Het
Usp17le	C	A	7: 104,768,460	A492S	probably damaging	Het
Vmn1r213	A	T	13: 23,011,762	M172L	probably benign	Het
Vmn1r71	G	A	7: 10,748,311	T84I	probably benign	Het
Vmn2r109	C	T	17: 20,541,074	V674M	probably damaging	Het
Vmn2r19	A	T	6: 123,335,986	I672F	possibly damaging	Het
Vmn2r77	T	C	7: 86,801,494	V196A	probably benign	Het
Xdh	T	A	17: 73,898,362	H1036L	probably damaging	Het
Zfp930	T	A	8: 69,228,296	Y214*	probably null	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTGACAACCACTGGTCTAAAGATACCT -3'
(R):5'- TGAGTCTCTTGTCTCTTTGTAACAGCAC -3'

Sequencing Primer
(F):5'- gcctcaaattcctagagatccac -3'
(R):5'- CGGGGAACTTTATTCATATCCTGAG -3'

Posted On

2013-04-24