Incidental Mutation 'R4155:Rpap1'
ID 315075
Institutional Source Beutler Lab
Gene Symbol Rpap1
Ensembl Gene ENSMUSG00000034032
Gene Name RNA polymerase II associated protein 1
Synonyms A730023M06Rik, 1190005L06Rik
MMRRC Submission 040999-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R4155 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 119594440-119618018 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 119604660 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 416 (R416H)
Ref Sequence ENSEMBL: ENSMUSP00000138873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048493] [ENSMUST00000099529] [ENSMUST00000110793] [ENSMUST00000136419] [ENSMUST00000184294]
AlphaFold Q80TE0
Predicted Effect probably damaging
Transcript: ENSMUST00000048493
AA Change: R416H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037275
Gene: ENSMUSG00000034032
AA Change: R416H

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 225 270 2.4e-21 PFAM
Pfam:RPAP1_C 372 438 1.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099529
AA Change: R416H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097127
Gene: ENSMUSG00000034032
AA Change: R416H

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110793
AA Change: R416H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106420
Gene: ENSMUSG00000034032
AA Change: R416H

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133146
Predicted Effect probably benign
Transcript: ENSMUST00000136419
SMART Domains Protein: ENSMUSP00000138619
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139311
Predicted Effect probably damaging
Transcript: ENSMUST00000184294
AA Change: R416H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138873
Gene: ENSMUSG00000034032
AA Change: R416H

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 4.8e-22 PFAM
Pfam:RPAP1_C 370 440 1.2e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141800
Meta Mutation Damage Score 0.8540 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein forms part of the RNA polymerase II (RNAPII) enzyme complex and may recruit RNAPII to chromatin through its interaction with acetylated histones. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,644,018 (GRCm39) F69I possibly damaging Het
Akt3 A G 1: 176,924,543 (GRCm39) I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Armc2 A G 10: 41,887,863 (GRCm39) V40A probably damaging Het
Ash2l A G 8: 26,307,482 (GRCm39) Y485H probably damaging Het
Atr T A 9: 95,770,177 (GRCm39) C1202* probably null Het
Bcl11b A T 12: 107,883,684 (GRCm39) probably null Het
Birc6 C A 17: 74,903,934 (GRCm39) S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,162,652 (GRCm39) probably benign Het
Bsx A G 9: 40,787,632 (GRCm39) E102G probably benign Het
Casq2 A T 3: 102,040,418 (GRCm39) probably null Het
Ccpg1 C A 9: 72,919,449 (GRCm39) Q355K probably benign Het
Copa T G 1: 171,928,992 (GRCm39) N251K probably damaging Het
Cst8 C A 2: 148,641,996 (GRCm39) A31E possibly damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Ecd A G 14: 20,374,632 (GRCm39) S503P probably damaging Het
Fbn2 C A 18: 58,156,359 (GRCm39) E2487* probably null Het
Hoxd9 A G 2: 74,529,667 (GRCm39) I308V probably benign Het
Ica1l G A 1: 60,053,052 (GRCm39) A162V possibly damaging Het
Kcnj15 A T 16: 95,097,166 (GRCm39) K263* probably null Het
Mettl4 T C 17: 95,048,003 (GRCm39) M213V probably benign Het
Nalf1 T A 8: 9,283,023 (GRCm39) Y342F possibly damaging Het
Ncan C A 8: 70,562,727 (GRCm39) E510D possibly damaging Het
Ndufs4 A T 13: 114,444,390 (GRCm39) S129R probably benign Het
Or14a259 T A 7: 86,013,270 (GRCm39) I92L probably benign Het
Or4c127 A G 2: 89,833,004 (GRCm39) S85G probably benign Het
Or52s19 T C 7: 103,008,363 (GRCm39) T13A probably benign Het
Or8d1b A T 9: 38,887,451 (GRCm39) T160S probably damaging Het
P2rx5 A G 11: 73,062,655 (GRCm39) T455A probably damaging Het
Pcdh1 T A 18: 38,336,159 (GRCm39) T159S probably damaging Het
Poln A G 5: 34,166,993 (GRCm39) V755A possibly damaging Het
Pou4f1 C T 14: 104,705,153 (GRCm39) S6N possibly damaging Het
Samd4 T A 14: 47,290,403 (GRCm39) M170K possibly damaging Het
Srgn A G 10: 62,333,613 (GRCm39) F55L possibly damaging Het
Tmcc1 C T 6: 116,110,765 (GRCm39) G176D probably benign Het
Tmem232 A T 17: 65,743,328 (GRCm39) M321K probably damaging Het
Tnfsf11 A G 14: 78,537,309 (GRCm39) M118T probably benign Het
Tns1 T A 1: 73,953,790 (GRCm39) N1848Y probably damaging Het
Ttc27 T G 17: 75,147,455 (GRCm39) I669S probably benign Het
Uaca A G 9: 60,779,035 (GRCm39) S1141G probably benign Het
Usp34 T A 11: 23,367,676 (GRCm39) V1671E probably damaging Het
Wdr64 T A 1: 175,597,172 (GRCm39) L73H probably benign Het
Zfp410 G A 12: 84,374,206 (GRCm39) R181H probably damaging Het
Other mutations in Rpap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Rpap1 APN 2 119,613,189 (GRCm39) missense possibly damaging 0.50
IGL02009:Rpap1 APN 2 119,610,594 (GRCm39) missense possibly damaging 0.51
IGL02068:Rpap1 APN 2 119,613,135 (GRCm39) missense probably benign 0.02
IGL02100:Rpap1 APN 2 119,599,807 (GRCm39) missense probably benign 0.06
IGL02528:Rpap1 APN 2 119,605,431 (GRCm39) splice site probably null
IGL02530:Rpap1 APN 2 119,613,720 (GRCm39) splice site probably benign
IGL02747:Rpap1 APN 2 119,604,609 (GRCm39) missense probably damaging 0.98
IGL03371:Rpap1 APN 2 119,605,538 (GRCm39) splice site probably benign
R0138:Rpap1 UTSW 2 119,595,380 (GRCm39) splice site probably null
R0325:Rpap1 UTSW 2 119,602,321 (GRCm39) missense probably benign
R0616:Rpap1 UTSW 2 119,608,601 (GRCm39) missense probably damaging 1.00
R1081:Rpap1 UTSW 2 119,601,750 (GRCm39) missense probably damaging 1.00
R1657:Rpap1 UTSW 2 119,614,259 (GRCm39) missense possibly damaging 0.53
R1837:Rpap1 UTSW 2 119,600,366 (GRCm39) critical splice donor site probably null
R2307:Rpap1 UTSW 2 119,614,247 (GRCm39) missense probably benign 0.00
R2308:Rpap1 UTSW 2 119,614,247 (GRCm39) missense probably benign 0.00
R2375:Rpap1 UTSW 2 119,600,888 (GRCm39) missense possibly damaging 0.50
R2507:Rpap1 UTSW 2 119,610,535 (GRCm39) critical splice donor site probably null
R2508:Rpap1 UTSW 2 119,610,535 (GRCm39) critical splice donor site probably null
R4156:Rpap1 UTSW 2 119,604,660 (GRCm39) missense probably damaging 1.00
R4157:Rpap1 UTSW 2 119,604,660 (GRCm39) missense probably damaging 1.00
R4657:Rpap1 UTSW 2 119,605,487 (GRCm39) missense probably benign 0.03
R4837:Rpap1 UTSW 2 119,608,732 (GRCm39) missense probably benign 0.32
R4880:Rpap1 UTSW 2 119,614,346 (GRCm39) missense probably damaging 0.97
R5010:Rpap1 UTSW 2 119,600,522 (GRCm39) missense probably benign
R5111:Rpap1 UTSW 2 119,601,728 (GRCm39) missense probably damaging 1.00
R5650:Rpap1 UTSW 2 119,604,331 (GRCm39) missense probably benign
R6144:Rpap1 UTSW 2 119,603,128 (GRCm39) nonsense probably null
R6353:Rpap1 UTSW 2 119,607,377 (GRCm39) splice site probably null
R6646:Rpap1 UTSW 2 119,610,612 (GRCm39) missense probably benign 0.03
R6731:Rpap1 UTSW 2 119,608,777 (GRCm39) missense probably benign
R6872:Rpap1 UTSW 2 119,605,850 (GRCm39) missense probably damaging 1.00
R6878:Rpap1 UTSW 2 119,608,657 (GRCm39) missense probably damaging 1.00
R7060:Rpap1 UTSW 2 119,604,043 (GRCm39) missense probably damaging 1.00
R7558:Rpap1 UTSW 2 119,601,735 (GRCm39) missense probably benign
R7640:Rpap1 UTSW 2 119,594,891 (GRCm39) missense possibly damaging 0.63
R7862:Rpap1 UTSW 2 119,605,893 (GRCm39) critical splice acceptor site probably null
R8055:Rpap1 UTSW 2 119,595,284 (GRCm39) missense probably benign 0.13
R8934:Rpap1 UTSW 2 119,599,730 (GRCm39) critical splice donor site probably null
R9032:Rpap1 UTSW 2 119,608,776 (GRCm39) missense probably benign 0.00
R9220:Rpap1 UTSW 2 119,604,669 (GRCm39) missense probably damaging 0.99
R9422:Rpap1 UTSW 2 119,613,519 (GRCm39) intron probably benign
R9651:Rpap1 UTSW 2 119,598,484 (GRCm39) missense probably damaging 1.00
R9776:Rpap1 UTSW 2 119,607,278 (GRCm39) missense probably benign 0.00
X0028:Rpap1 UTSW 2 119,601,543 (GRCm39) missense probably benign
Z1177:Rpap1 UTSW 2 119,614,233 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAACCTTTGCTGACCCGTTAC -3'
(R):5'- ACATCCCTGTTTGCTGTGTG -3'

Sequencing Primer
(F):5'- GACCCGTTACTGCACATTTG -3'
(R):5'- GGTGCCATTGCTCTGTGC -3'
Posted On 2015-05-14