Incidental Mutation 'R4155:Cst8'
ID315077
Institutional Source Beutler Lab
Gene Symbol Cst8
Ensembl Gene ENSMUSG00000027442
Gene Namecystatin 8 (cystatin-related epididymal spermatogenic)
SynonymsCres, Cst-rs1
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location148798785-148805595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 148800076 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 31 (A31E)
Ref Sequence ENSEMBL: ENSMUSP00000105573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028931] [ENSMUST00000109947]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028931
AA Change: A31E

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028931
Gene: ENSMUSG00000027442
AA Change: A31E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CY 32 140 6.18e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109947
AA Change: A31E

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105573
Gene: ENSMUSG00000027442
AA Change: A31E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CY 32 140 6.18e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154737
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a protein similar to type 2 cystatins. The encoded protein exhibits highly tissue-specific expression in the reproductive tract, suggesting implicit roles in reproduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Cst8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4012:Cst8 UTSW 2 148804702 splice site probably benign
R5375:Cst8 UTSW 2 148804583 missense probably benign 0.03
R6257:Cst8 UTSW 2 148805445 missense probably damaging 1.00
R7042:Cst8 UTSW 2 148799876 splice site probably null
Predicted Primers PCR Primer
(F):5'- TACAGAGGCAGCAGTGACTG -3'
(R):5'- GTTTGTGCATAGCAAGTCACAC -3'

Sequencing Primer
(F):5'- GTGACTGCTACTCTGAAGCTCAAG -3'
(R):5'- GTGCATAGCAAGTCACACATTTAG -3'
Posted On2015-05-14