Incidental Mutation 'R4155:Casq2'
ID315078
Institutional Source Beutler Lab
Gene Symbol Casq2
Ensembl Gene ENSMUSG00000027861
Gene Namecalsequestrin 2
SynonymsESTM52, cCSQ, cardiac calsequestrin
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location102086415-102146514 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to T at 102133102 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029454] [ENSMUST00000164123] [ENSMUST00000165540]
Predicted Effect probably benign
Transcript: ENSMUST00000029454
SMART Domains Protein: ENSMUSP00000029454
Gene: ENSMUSG00000027861

DomainStartEndE-ValueType
Pfam:Calsequestrin 1 382 1.4e-226 PFAM
Pfam:Thioredoxin_6 171 364 7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159521
Predicted Effect probably benign
Transcript: ENSMUST00000164123
SMART Domains Protein: ENSMUSP00000131232
Gene: ENSMUSG00000027861

DomainStartEndE-ValueType
Pfam:Calsequestrin 2 108 1.3e-46 PFAM
Pfam:Thioredoxin_6 101 293 6.1e-20 PFAM
Pfam:Calsequestrin 106 311 1.9e-127 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165540
SMART Domains Protein: ENSMUSP00000130482
Gene: ENSMUSG00000027861

DomainStartEndE-ValueType
Pfam:Calsequestrin 1 386 7.4e-224 PFAM
Pfam:Thioredoxin_6 171 367 9.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197326
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene specifies the cardiac muscle family member of the calsequestrin family. Calsequestrin is localized to the sarcoplasmic reticulum in cardiac and slow skeletal muscle cells. The protein is a calcium binding protein that stores calcium for muscle function. Mutations in this gene cause stress-induced polymorphic ventricular tachycardia, also referred to as catecholaminergic polymorphic ventricular tachycardia 2 (CPVT2), a disease characterized by bidirectional ventricular tachycardia that may lead to cardiac arrest. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene cause impaired intracellular calcium regulation in cardiac myocytes and lead to an arrhythmogenic syndrome called catecholaminergic polymorphic ventricular tachycardia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Casq2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Casq2 APN 3 102110231 splice site probably benign
IGL02597:Casq2 APN 3 102126637 missense probably damaging 1.00
IGL02863:Casq2 APN 3 102144175 missense possibly damaging 0.84
IGL02902:Casq2 APN 3 102086797 nonsense probably null
IGL03176:Casq2 APN 3 102126654 missense possibly damaging 0.50
R0126:Casq2 UTSW 3 102133399 missense probably damaging 1.00
R0653:Casq2 UTSW 3 102113166 critical splice donor site probably null
R1036:Casq2 UTSW 3 102142215 missense probably damaging 1.00
R1052:Casq2 UTSW 3 102144234 splice site probably null
R1158:Casq2 UTSW 3 102116883 missense probably damaging 1.00
R2886:Casq2 UTSW 3 102144218 missense probably damaging 1.00
R3001:Casq2 UTSW 3 102145201 missense probably damaging 0.99
R3002:Casq2 UTSW 3 102145201 missense probably damaging 0.99
R4715:Casq2 UTSW 3 102110244 missense probably benign 0.00
R6013:Casq2 UTSW 3 102145629 unclassified probably null
R6778:Casq2 UTSW 3 102127931 splice site probably null
R6836:Casq2 UTSW 3 102086760 missense probably damaging 1.00
R6844:Casq2 UTSW 3 102110262 missense possibly damaging 0.70
R7055:Casq2 UTSW 3 102142245 missense probably damaging 1.00
R7638:Casq2 UTSW 3 102086700 missense possibly damaging 0.73
R7761:Casq2 UTSW 3 102145264 missense probably damaging 1.00
R7997:Casq2 UTSW 3 102086842 missense probably damaging 0.98
R8169:Casq2 UTSW 3 102110312 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGATAACTCCTGGTGGGGAAC -3'
(R):5'- ATATGTGTCAGGGGCAGCAAC -3'

Sequencing Primer
(F):5'- GGAACCTCAAAATTCACATTTGCAG -3'
(R):5'- GCAGCAACACAGAAGCTGGC -3'
Posted On2015-05-14