Incidental Mutation 'R4155:Poln'
ID315081
Institutional Source Beutler Lab
Gene Symbol Poln
Ensembl Gene ENSMUSG00000045102
Gene NameDNA polymerase N
SynonymsPOL4P
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34007179-34169448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34009649 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 755 (V755A)
Ref Sequence ENSEMBL: ENSMUSP00000143793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042954] [ENSMUST00000056355] [ENSMUST00000202409] [ENSMUST00000202638]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042954
AA Change: V799A

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036110
Gene: ENSMUSG00000045102
AA Change: V799A

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
POLAc 605 814 7.88e-67 SMART
low complexity region 829 843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056355
SMART Domains Protein: ENSMUSP00000059313
Gene: ENSMUSG00000048142

DomainStartEndE-ValueType
low complexity region 34 74 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:Acetyltransf_10 146 261 9.4e-13 PFAM
Pfam:Acetyltransf_8 156 280 3e-11 PFAM
Pfam:Acetyltransf_7 177 263 2.8e-13 PFAM
Pfam:Acetyltransf_1 184 262 7.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201251
Predicted Effect probably benign
Transcript: ENSMUST00000202409
AA Change: V781A

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144578
Gene: ENSMUSG00000045102
AA Change: V781A

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 587 796 2.6e-69 SMART
low complexity region 811 825 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202638
AA Change: V755A

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143793
Gene: ENSMUSG00000045102
AA Change: V755A

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 605 770 3e-37 SMART
low complexity region 785 799 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202825
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced meiotic double-strand breaks at a meiotic recombination hot spot harboring insertion/deletion polymorphisms, but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Poln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00803:Poln APN 5 34122760 missense probably benign 0.17
IGL00938:Poln APN 5 34129224 missense probably damaging 1.00
IGL02081:Poln APN 5 34129139 missense probably benign
IGL02411:Poln APN 5 34113322 nonsense probably null
IGL02440:Poln APN 5 34129130 missense probably damaging 1.00
IGL02484:Poln APN 5 34129377 missense probably damaging 1.00
IGL02577:Poln APN 5 34113335 missense probably benign 0.03
IGL03113:Poln APN 5 34116862 missense probably benign 0.01
R0034:Poln UTSW 5 34115418 missense possibly damaging 0.78
R0034:Poln UTSW 5 34115418 missense possibly damaging 0.78
R0068:Poln UTSW 5 34077088 splice site probably benign
R0068:Poln UTSW 5 34077088 splice site probably benign
R0325:Poln UTSW 5 34149764 missense probably benign 0.00
R0578:Poln UTSW 5 34014338 missense probably damaging 1.00
R0631:Poln UTSW 5 34118958 missense possibly damaging 0.93
R1171:Poln UTSW 5 34103940 missense probably damaging 1.00
R1266:Poln UTSW 5 34133109 critical splice donor site probably null
R1418:Poln UTSW 5 34078975 missense probably benign 0.00
R1449:Poln UTSW 5 34014338 missense probably damaging 1.00
R1558:Poln UTSW 5 34032799 missense probably benign 0.04
R1723:Poln UTSW 5 34122672 missense probably benign 0.16
R1806:Poln UTSW 5 34107150 splice site probably benign
R4124:Poln UTSW 5 34103951 missense probably benign 0.32
R4125:Poln UTSW 5 34103951 missense probably benign 0.32
R4128:Poln UTSW 5 34103951 missense probably benign 0.32
R4353:Poln UTSW 5 34129452 missense probably benign 0.00
R4717:Poln UTSW 5 34129448 missense possibly damaging 0.46
R4788:Poln UTSW 5 34129331 missense probably benign 0.30
R4981:Poln UTSW 5 34107085 critical splice donor site probably null
R5456:Poln UTSW 5 34007442 missense possibly damaging 0.95
R6020:Poln UTSW 5 34109431 missense probably damaging 0.99
R6484:Poln UTSW 5 34129513 missense probably benign 0.01
R7134:Poln UTSW 5 34118996 missense possibly damaging 0.86
R7639:Poln UTSW 5 34133151 missense possibly damaging 0.77
R7764:Poln UTSW 5 34116807 critical splice donor site probably null
R7874:Poln UTSW 5 34024350 missense probably damaging 1.00
R8039:Poln UTSW 5 34122672 missense probably benign 0.16
R8315:Poln UTSW 5 34109373 missense probably benign 0.00
R8320:Poln UTSW 5 34149827 missense possibly damaging 0.70
R8340:Poln UTSW 5 34149774 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTGCACAGAAGCTTCATG -3'
(R):5'- AGCTGTCTGATGATAAACAACCC -3'

Sequencing Primer
(F):5'- CACAGAAGCTTCATGGCTATTCTGG -3'
(R):5'- CCCAGATCATAGTGCCAGGATG -3'
Posted On2015-05-14