Mutagenetix > Incidental Mutation

Incidental Mutation 'R4155:Blm'

315084

Institutional Source

Beutler Lab

Gene Symbol

Blm

Ensembl Gene

ENSMUSG00000030528

Gene Name

Bloom syndrome, RecQ like helicase

Synonyms

MMRRC Submission

040999-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4155 (G1)

Quality Score

127

Status

Not validated

Chromosome

Chromosomal Location

80454733-80535119 bp(-) (GRCm38)

Type of Mutation

small deletion (1 aa in frame mutation)

DNA Base Change (assembly)

GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC to GCCTCCTCCTCCTCCTCCTCCTCCTCC at 80512904 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000127995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]

AlphaFold

O88700

Predicted Effect

probably benign
Transcript: ENSMUST00000081314

SMART Domains

Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528

Domain	Start	End	E-Value	Type
low complexity region	46	54	N/A	INTRINSIC
low complexity region	118	132	N/A	INTRINSIC
low complexity region	142	169	N/A	INTRINSIC
low complexity region	219	231	N/A	INTRINSIC
low complexity region	318	335	N/A	INTRINSIC
Pfam:BDHCT	376	416	5.5e-27	PFAM
low complexity region	557	574	N/A	INTRINSIC
DEXDc	672	873	1.59e-29	SMART
HELICc	910	992	1.29e-24	SMART
RQC	1084	1198	1.43e-15	SMART
HRDC	1217	1297	9.4e-20	SMART
low complexity region	1357	1371	N/A	INTRINSIC
low complexity region	1378	1392	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166096

Predicted Effect

probably benign
Transcript: ENSMUST00000170315

SMART Domains

Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528

Domain	Start	End	E-Value	Type
Pfam:BLM_N	4	375	1.1e-161	PFAM
Pfam:BDHCT	380	419	6.4e-25	PFAM
Pfam:BDHCT_assoc	433	658	8.8e-108	PFAM
DEXDc	675	876	1.59e-29	SMART
HELICc	913	995	1.29e-24	SMART
Pfam:RecQ_Zn_bind	1006	1078	1.5e-19	PFAM
RQC	1087	1201	1.43e-15	SMART
HRDC	1220	1300	9.4e-20	SMART
low complexity region	1360	1374	N/A	INTRINSIC
low complexity region	1381	1395	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205263

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410004B18Rik	T	A	3: 145,938,263	F69I	possibly damaging	Het
Akt3	A	G	1: 177,096,977	I184T	possibly damaging	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Armc2	A	G	10: 42,011,867	V40A	probably damaging	Het
Ash2l	A	G	8: 25,817,454	Y485H	probably damaging	Het
Atr	T	A	9: 95,888,124	C1202*	probably null	Het
Bcl11b	A	T	12: 107,917,425		probably null	Het
Birc6	C	A	17: 74,596,939	S1242R	probably benign	Het
Bsx	A	G	9: 40,876,336	E102G	probably benign	Het
Casq2	A	T	3: 102,133,102		probably null	Het
Ccpg1	C	A	9: 73,012,167	Q355K	probably benign	Het
Copa	T	G	1: 172,101,425	N251K	probably damaging	Het
Cst8	C	A	2: 148,800,076	A31E	possibly damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Ecd	A	G	14: 20,324,564	S503P	probably damaging	Het
Fam155a	T	A	8: 9,233,023	Y342F	possibly damaging	Het
Fbn2	C	A	18: 58,023,287	E2487*	probably null	Het
Hoxd9	A	G	2: 74,699,323	I308V	probably benign	Het
Ica1l	G	A	1: 60,013,893	A162V	possibly damaging	Het
Kcnj15	A	T	16: 95,296,307	K263*	probably null	Het
Mettl4	T	C	17: 94,740,575	M213V	probably benign	Het
Ncan	C	A	8: 70,110,077	E510D	possibly damaging	Het
Ndufs4	A	T	13: 114,307,854	S129R	probably benign	Het
Olfr1262	A	G	2: 90,002,660	S85G	probably benign	Het
Olfr305	T	A	7: 86,364,062	I92L	probably benign	Het
Olfr601	T	C	7: 103,359,156	T13A	probably benign	Het
Olfr933	A	T	9: 38,976,155	T160S	probably damaging	Het
P2rx5	A	G	11: 73,171,829	T455A	probably damaging	Het
Pcdh1	T	A	18: 38,203,106	T159S	probably damaging	Het
Poln	A	G	5: 34,009,649	V755A	possibly damaging	Het
Pou4f1	C	T	14: 104,467,717	S6N	possibly damaging	Het
Rpap1	C	T	2: 119,774,179	R416H	probably damaging	Het
Samd4	T	A	14: 47,052,946	M170K	possibly damaging	Het
Srgn	A	G	10: 62,497,834	F55L	possibly damaging	Het
Tmcc1	C	T	6: 116,133,804	G176D	probably benign	Het
Tmem232	A	T	17: 65,436,333	M321K	probably damaging	Het
Tnfsf11	A	G	14: 78,299,869	M118T	probably benign	Het
Tns1	T	A	1: 73,914,631	N1848Y	probably damaging	Het
Ttc27	T	G	17: 74,840,460	I669S	probably benign	Het
Uaca	A	G	9: 60,871,753	S1141G	probably benign	Het
Usp34	T	A	11: 23,417,676	V1671E	probably damaging	Het
Wdr64	T	A	1: 175,769,606	L73H	probably benign	Het
Zfp410	G	A	12: 84,327,432	R181H	probably damaging	Het

Other mutations in Blm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01531:Blm	APN	7	80474071	missense	probably damaging	1.00
IGL01658:Blm	APN	7	80463941	missense	probably damaging	0.98
IGL02048:Blm	APN	7	80502961	splice site	probably benign
IGL02060:Blm	APN	7	80514580	splice site	probably benign
IGL02063:Blm	APN	7	80509419	nonsense	probably null
IGL02102:Blm	APN	7	80469756	missense	probably damaging	1.00
IGL02420:Blm	APN	7	80496006	missense	probably damaging	1.00
IGL02452:Blm	APN	7	80503377	splice site	probably null
IGL02566:Blm	APN	7	80474196	missense	probably damaging	1.00
IGL03387:Blm	APN	7	80494147	missense	probably damaging	1.00
FR4304:Blm	UTSW	7	80463773	frame shift	probably null
FR4304:Blm	UTSW	7	80512919	small insertion	probably benign
FR4340:Blm	UTSW	7	80463767	unclassified	probably benign
FR4340:Blm	UTSW	7	80512907	small insertion	probably benign
FR4340:Blm	UTSW	7	80512910	small insertion	probably benign
FR4449:Blm	UTSW	7	80512908	small insertion	probably benign
FR4548:Blm	UTSW	7	80463769	frame shift	probably null
FR4589:Blm	UTSW	7	80463770	frame shift	probably null
FR4737:Blm	UTSW	7	80463771	frame shift	probably null
FR4737:Blm	UTSW	7	80463774	frame shift	probably null
FR4976:Blm	UTSW	7	80463767	unclassified	probably benign
FR4976:Blm	UTSW	7	80512907	small insertion	probably benign
R0133:Blm	UTSW	7	80502367	missense	possibly damaging	0.93
R0194:Blm	UTSW	7	80464946	unclassified	probably benign
R0526:Blm	UTSW	7	80505893	nonsense	probably null
R0673:Blm	UTSW	7	80499751	critical splice donor site	probably null
R0972:Blm	UTSW	7	80513370	missense	probably benign
R0980:Blm	UTSW	7	80499958	splice site	probably null
R1120:Blm	UTSW	7	80481466	missense	probably damaging	1.00
R1301:Blm	UTSW	7	80455417	nonsense	probably null
R1769:Blm	UTSW	7	80513370	missense	probably benign
R1866:Blm	UTSW	7	80494114	missense	probably benign	0.08
R1874:Blm	UTSW	7	80497418	missense	probably damaging	1.00
R1966:Blm	UTSW	7	80513186	missense	possibly damaging	0.86
R1991:Blm	UTSW	7	80505949	splice site	probably null
R2013:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2014:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2015:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2016:Blm	UTSW	7	80505926	missense	probably benign	0.26
R2103:Blm	UTSW	7	80505949	splice site	probably null
R2161:Blm	UTSW	7	80481370	splice site	probably null
R2215:Blm	UTSW	7	80499847	missense	possibly damaging	0.69
R3689:Blm	UTSW	7	80513079	missense	possibly damaging	0.56
R4049:Blm	UTSW	7	80502862	missense	probably benign	0.04
R4695:Blm	UTSW	7	80494228	missense	probably damaging	1.00
R4774:Blm	UTSW	7	80463848	missense	probably damaging	1.00
R4833:Blm	UTSW	7	80466826	missense	probably benign
R4835:Blm	UTSW	7	80509546	missense	probably benign	0.41
R4994:Blm	UTSW	7	80458825	missense	probably benign	0.00
R5039:Blm	UTSW	7	80505873	missense	possibly damaging	0.50
R5330:Blm	UTSW	7	80458936	missense	possibly damaging	0.73
R5375:Blm	UTSW	7	80513229	missense	probably benign	0.00
R5408:Blm	UTSW	7	80502622	missense	probably benign	0.01
R5574:Blm	UTSW	7	80499773	missense	probably damaging	1.00
R5606:Blm	UTSW	7	80460832	splice site	probably null
R5702:Blm	UTSW	7	80458927	missense	probably benign	0.13
R5809:Blm	UTSW	7	80464844	missense	probably damaging	1.00
R6114:Blm	UTSW	7	80513487	missense	probably damaging	1.00
R6157:Blm	UTSW	7	80512985	missense	probably benign	0.18
R6163:Blm	UTSW	7	80512904	small deletion	probably benign
R6254:Blm	UTSW	7	80480342	missense	probably benign	0.04
R6266:Blm	UTSW	7	80499940	missense	probably benign	0.03
R6364:Blm	UTSW	7	80494526	nonsense	probably null
R6446:Blm	UTSW	7	80512904	small deletion	probably benign
R6502:Blm	UTSW	7	80481475	missense	probably damaging	0.98
R6700:Blm	UTSW	7	80463850	missense	possibly damaging	0.91
R7002:Blm	UTSW	7	80469753	missense	probably benign	0.00
R7105:Blm	UTSW	7	80499768	missense	probably benign	0.44
R7320:Blm	UTSW	7	80455354	nonsense	probably null
R7465:Blm	UTSW	7	80513115	missense	probably benign	0.02
R7561:Blm	UTSW	7	80502528	missense	probably damaging	0.99
R8500:Blm	UTSW	7	80455284	missense	probably damaging	1.00
R8543:Blm	UTSW	7	80494216	missense	probably damaging	0.98
R8774-TAIL:Blm	UTSW	7	80512907	small insertion	probably benign
R8774-TAIL:Blm	UTSW	7	80512918	small insertion	probably benign
R8774-TAIL:Blm	UTSW	7	80512919	small insertion	probably benign
R8775-TAIL:Blm	UTSW	7	80512931	small insertion	probably benign
R8860:Blm	UTSW	7	80494528	missense	probably benign	0.30
R8928:Blm	UTSW	7	80512904	small deletion	probably benign
R9089:Blm	UTSW	7	80513119	missense	probably damaging	1.00
R9363:Blm	UTSW	7	80458915	missense	probably damaging	1.00
RF001:Blm	UTSW	7	80512903	small insertion	probably benign
RF001:Blm	UTSW	7	80512906	small insertion	probably benign
RF001:Blm	UTSW	7	80512927	small insertion	probably benign
RF002:Blm	UTSW	7	80512905	small insertion	probably benign
RF002:Blm	UTSW	7	80512927	small insertion	probably benign
RF007:Blm	UTSW	7	80512933	nonsense	probably null
RF016:Blm	UTSW	7	80512926	nonsense	probably null
RF018:Blm	UTSW	7	80512926	nonsense	probably null
RF027:Blm	UTSW	7	80512914	frame shift	probably null
RF028:Blm	UTSW	7	80512905	nonsense	probably null
RF031:Blm	UTSW	7	80512906	small insertion	probably benign
RF031:Blm	UTSW	7	80512923	small insertion	probably benign
RF032:Blm	UTSW	7	80512930	small insertion	probably benign
RF036:Blm	UTSW	7	80512914	nonsense	probably null
RF044:Blm	UTSW	7	80512930	small insertion	probably benign
RF053:Blm	UTSW	7	80512921	small insertion	probably benign
RF064:Blm	UTSW	7	80512923	nonsense	probably null
X0061:Blm	UTSW	7	80458850	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- ACAACTGTCCTGTGTACCG -3'
(R):5'- ATGCGTTTGCTTCACTGGC -3'

Sequencing Primer
(F):5'- CCCAGTGCTCAGCTTTAGATTAG -3'
(R):5'- GCTTCACTGGCTAAAAATCCTG -3'

Posted On

2015-05-14