Incidental Mutation 'R4155:Olfr305'
ID315085
Institutional Source Beutler Lab
Gene Symbol Olfr305
Ensembl Gene ENSMUSG00000055571
Gene Nameolfactory receptor 305
SynonymsMOR219-2, GA_x6K02T2NHDJ-9744055-9745014
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86360854-86366928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86364062 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 92 (I92L)
Ref Sequence ENSEMBL: ENSMUSP00000149883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069236] [ENSMUST00000213255] [ENSMUST00000213869] [ENSMUST00000216700]
Predicted Effect probably benign
Transcript: ENSMUST00000069236
AA Change: I92L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000068650
Gene: ENSMUSG00000055571
AA Change: I92L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-40 PFAM
Pfam:7tm_1 39 288 3.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213255
AA Change: I92L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000213869
AA Change: I92L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000216700
AA Change: I92L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Olfr305
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Olfr305 APN 7 86363560 missense possibly damaging 0.46
IGL02102:Olfr305 APN 7 86363866 missense probably benign 0.25
IGL02424:Olfr305 APN 7 86363480 missense probably benign 0.02
IGL02664:Olfr305 APN 7 86363603 missense possibly damaging 0.94
IGL03167:Olfr305 APN 7 86363920 missense probably damaging 1.00
R0035:Olfr305 UTSW 7 86364187 missense possibly damaging 0.95
R0373:Olfr305 UTSW 7 86363805 nonsense probably null
R0510:Olfr305 UTSW 7 86363827 missense probably benign 0.21
R2214:Olfr305 UTSW 7 86364206 missense probably benign 0.01
R3147:Olfr305 UTSW 7 86363884 missense probably benign 0.01
R3623:Olfr305 UTSW 7 86364100 missense probably benign 0.02
R4332:Olfr305 UTSW 7 86363872 missense probably benign 0.01
R4785:Olfr305 UTSW 7 86363735 missense probably damaging 1.00
R4834:Olfr305 UTSW 7 86363744 missense probably benign 0.21
R4871:Olfr305 UTSW 7 86363484 missense probably damaging 1.00
R5161:Olfr305 UTSW 7 86364338 splice site probably null
R5254:Olfr305 UTSW 7 86364190 missense possibly damaging 0.82
R6430:Olfr305 UTSW 7 86363973 nonsense probably null
R7734:Olfr305 UTSW 7 86364268 missense not run
RF010:Olfr305 UTSW 7 86363386 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAATAATCCAGTGCCCCAGG -3'
(R):5'- CATGAGCTACAGATTCTATGTGGAG -3'

Sequencing Primer
(F):5'- TCCAGTGCCCCAGGAAACG -3'
(R):5'- GTGGATCTGAAGCTCCAA -3'
Posted On2015-05-14