Incidental Mutation 'R4155:Or14a259'
ID 315085
Institutional Source Beutler Lab
Gene Symbol Or14a259
Ensembl Gene ENSMUSG00000055571
Gene Name olfactory receptor family 14 subfamily A member 259
Synonyms GA_x6K02T2NHDJ-9744055-9745014, Olfr305, MOR219-2
MMRRC Submission 040999-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R4155 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 86012584-86013543 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86013270 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 92 (I92L)
Ref Sequence ENSEMBL: ENSMUSP00000149883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069236] [ENSMUST00000213255] [ENSMUST00000213869] [ENSMUST00000216700]
AlphaFold Q7TS02
Predicted Effect probably benign
Transcript: ENSMUST00000069236
AA Change: I92L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000068650
Gene: ENSMUSG00000055571
AA Change: I92L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-40 PFAM
Pfam:7tm_1 39 288 3.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213255
AA Change: I92L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000213869
AA Change: I92L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000216700
AA Change: I92L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,644,018 (GRCm39) F69I possibly damaging Het
Akt3 A G 1: 176,924,543 (GRCm39) I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Armc2 A G 10: 41,887,863 (GRCm39) V40A probably damaging Het
Ash2l A G 8: 26,307,482 (GRCm39) Y485H probably damaging Het
Atr T A 9: 95,770,177 (GRCm39) C1202* probably null Het
Bcl11b A T 12: 107,883,684 (GRCm39) probably null Het
Birc6 C A 17: 74,903,934 (GRCm39) S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,162,652 (GRCm39) probably benign Het
Bsx A G 9: 40,787,632 (GRCm39) E102G probably benign Het
Casq2 A T 3: 102,040,418 (GRCm39) probably null Het
Ccpg1 C A 9: 72,919,449 (GRCm39) Q355K probably benign Het
Copa T G 1: 171,928,992 (GRCm39) N251K probably damaging Het
Cst8 C A 2: 148,641,996 (GRCm39) A31E possibly damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Ecd A G 14: 20,374,632 (GRCm39) S503P probably damaging Het
Fbn2 C A 18: 58,156,359 (GRCm39) E2487* probably null Het
Hoxd9 A G 2: 74,529,667 (GRCm39) I308V probably benign Het
Ica1l G A 1: 60,053,052 (GRCm39) A162V possibly damaging Het
Kcnj15 A T 16: 95,097,166 (GRCm39) K263* probably null Het
Mettl4 T C 17: 95,048,003 (GRCm39) M213V probably benign Het
Nalf1 T A 8: 9,283,023 (GRCm39) Y342F possibly damaging Het
Ncan C A 8: 70,562,727 (GRCm39) E510D possibly damaging Het
Ndufs4 A T 13: 114,444,390 (GRCm39) S129R probably benign Het
Or4c127 A G 2: 89,833,004 (GRCm39) S85G probably benign Het
Or52s19 T C 7: 103,008,363 (GRCm39) T13A probably benign Het
Or8d1b A T 9: 38,887,451 (GRCm39) T160S probably damaging Het
P2rx5 A G 11: 73,062,655 (GRCm39) T455A probably damaging Het
Pcdh1 T A 18: 38,336,159 (GRCm39) T159S probably damaging Het
Poln A G 5: 34,166,993 (GRCm39) V755A possibly damaging Het
Pou4f1 C T 14: 104,705,153 (GRCm39) S6N possibly damaging Het
Rpap1 C T 2: 119,604,660 (GRCm39) R416H probably damaging Het
Samd4 T A 14: 47,290,403 (GRCm39) M170K possibly damaging Het
Srgn A G 10: 62,333,613 (GRCm39) F55L possibly damaging Het
Tmcc1 C T 6: 116,110,765 (GRCm39) G176D probably benign Het
Tmem232 A T 17: 65,743,328 (GRCm39) M321K probably damaging Het
Tnfsf11 A G 14: 78,537,309 (GRCm39) M118T probably benign Het
Tns1 T A 1: 73,953,790 (GRCm39) N1848Y probably damaging Het
Ttc27 T G 17: 75,147,455 (GRCm39) I669S probably benign Het
Uaca A G 9: 60,779,035 (GRCm39) S1141G probably benign Het
Usp34 T A 11: 23,367,676 (GRCm39) V1671E probably damaging Het
Wdr64 T A 1: 175,597,172 (GRCm39) L73H probably benign Het
Zfp410 G A 12: 84,374,206 (GRCm39) R181H probably damaging Het
Other mutations in Or14a259
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Or14a259 APN 7 86,012,768 (GRCm39) missense possibly damaging 0.46
IGL02102:Or14a259 APN 7 86,013,074 (GRCm39) missense probably benign 0.25
IGL02424:Or14a259 APN 7 86,012,688 (GRCm39) missense probably benign 0.02
IGL02664:Or14a259 APN 7 86,012,811 (GRCm39) missense possibly damaging 0.94
IGL03167:Or14a259 APN 7 86,013,128 (GRCm39) missense probably damaging 1.00
R0035:Or14a259 UTSW 7 86,013,395 (GRCm39) missense possibly damaging 0.95
R0373:Or14a259 UTSW 7 86,013,013 (GRCm39) nonsense probably null
R0510:Or14a259 UTSW 7 86,013,035 (GRCm39) missense probably benign 0.21
R2214:Or14a259 UTSW 7 86,013,414 (GRCm39) missense probably benign 0.01
R3147:Or14a259 UTSW 7 86,013,092 (GRCm39) missense probably benign 0.01
R3623:Or14a259 UTSW 7 86,013,308 (GRCm39) missense probably benign 0.02
R4332:Or14a259 UTSW 7 86,013,080 (GRCm39) missense probably benign 0.01
R4785:Or14a259 UTSW 7 86,012,943 (GRCm39) missense probably damaging 1.00
R4834:Or14a259 UTSW 7 86,012,952 (GRCm39) missense probably benign 0.21
R4871:Or14a259 UTSW 7 86,012,692 (GRCm39) missense probably damaging 1.00
R5161:Or14a259 UTSW 7 86,013,546 (GRCm39) splice site probably null
R5254:Or14a259 UTSW 7 86,013,398 (GRCm39) missense possibly damaging 0.82
R6430:Or14a259 UTSW 7 86,013,181 (GRCm39) nonsense probably null
R7734:Or14a259 UTSW 7 86,013,476 (GRCm39) missense not run
R8520:Or14a259 UTSW 7 86,013,471 (GRCm39) missense probably benign 0.00
R8682:Or14a259 UTSW 7 86,013,373 (GRCm39) missense probably damaging 0.99
R9407:Or14a259 UTSW 7 86,013,194 (GRCm39) nonsense probably null
R9728:Or14a259 UTSW 7 86,012,771 (GRCm39) missense probably damaging 1.00
RF010:Or14a259 UTSW 7 86,012,594 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAATAATCCAGTGCCCCAGG -3'
(R):5'- CATGAGCTACAGATTCTATGTGGAG -3'

Sequencing Primer
(F):5'- TCCAGTGCCCCAGGAAACG -3'
(R):5'- GTGGATCTGAAGCTCCAA -3'
Posted On 2015-05-14