Incidental Mutation 'R4155:Ash2l'
ID315088
Institutional Source Beutler Lab
Gene Symbol Ash2l
Ensembl Gene ENSMUSG00000031575
Gene NameASH2 like histone lysine methyltransferase complex subunit
Synonyms
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location25815996-25847694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25817454 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 485 (Y485H)
Ref Sequence ENSEMBL: ENSMUSP00000106238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033979] [ENSMUST00000068892] [ENSMUST00000110608] [ENSMUST00000110609] [ENSMUST00000110610] [ENSMUST00000139946] [ENSMUST00000151856] [ENSMUST00000166078]
Predicted Effect probably benign
Transcript: ENSMUST00000033979
SMART Domains Protein: ENSMUSP00000033979
Gene: ENSMUSG00000031574

DomainStartEndE-ValueType
START 75 280 3.63e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068892
AA Change: Y607H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070957
Gene: ENSMUSG00000031575
AA Change: Y607H

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 36 59 N/A INTRINSIC
PDB:3S32|A 90 275 1e-136 PDB
Blast:PHD 103 146 2e-6 BLAST
low complexity region 280 306 N/A INTRINSIC
SPRY 413 577 4.87e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110608
AA Change: Y485H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106238
Gene: ENSMUSG00000031575
AA Change: Y485H

DomainStartEndE-ValueType
PDB:3S32|A 1 186 1e-137 PDB
Blast:PHD 14 57 2e-6 BLAST
low complexity region 191 217 N/A INTRINSIC
SPRY 324 455 1.13e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110609
AA Change: Y518H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106239
Gene: ENSMUSG00000031575
AA Change: Y518H

DomainStartEndE-ValueType
PDB:3S32|A 1 186 1e-137 PDB
Blast:PHD 14 57 2e-6 BLAST
low complexity region 191 217 N/A INTRINSIC
SPRY 324 488 4.87e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110610
AA Change: Y518H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106240
Gene: ENSMUSG00000031575
AA Change: Y518H

DomainStartEndE-ValueType
PDB:3S32|A 1 186 1e-137 PDB
Blast:PHD 14 57 2e-6 BLAST
low complexity region 191 217 N/A INTRINSIC
SPRY 324 488 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139946
SMART Domains Protein: ENSMUSP00000118346
Gene: ENSMUSG00000031575

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 36 59 N/A INTRINSIC
PDB:3S32|A 90 275 1e-141 PDB
Blast:PHD 103 146 1e-6 BLAST
transmembrane domain 278 300 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151856
SMART Domains Protein: ENSMUSP00000117488
Gene: ENSMUSG00000031575

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 36 59 N/A INTRINSIC
PDB:3S32|A 90 272 1e-125 PDB
Blast:PHD 103 146 1e-6 BLAST
transmembrane domain 286 305 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166078
AA Change: Y518H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132546
Gene: ENSMUSG00000031575
AA Change: Y518H

DomainStartEndE-ValueType
PDB:3S32|A 1 186 1e-137 PDB
Blast:PHD 14 57 2e-6 BLAST
low complexity region 191 217 N/A INTRINSIC
SPRY 324 488 4.87e-41 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele die before E8.5-E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Ash2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01835:Ash2l APN 8 25839840 missense probably damaging 1.00
IGL01913:Ash2l APN 8 25819624 critical splice donor site probably null
IGL02379:Ash2l APN 8 25822771 missense probably damaging 1.00
IGL03149:Ash2l APN 8 25818622 missense probably benign 0.00
R0639:Ash2l UTSW 8 25823291 missense possibly damaging 0.83
R1217:Ash2l UTSW 8 25822885 missense probably damaging 0.97
R1244:Ash2l UTSW 8 25817421 missense probably damaging 0.99
R1440:Ash2l UTSW 8 25827378 missense probably benign 0.27
R2282:Ash2l UTSW 8 25835042 missense probably damaging 0.99
R3013:Ash2l UTSW 8 25839764 missense probably damaging 0.96
R3721:Ash2l UTSW 8 25818625 missense probably damaging 1.00
R4727:Ash2l UTSW 8 25818595 missense probably damaging 0.99
R5637:Ash2l UTSW 8 25827311 missense probably damaging 1.00
R5973:Ash2l UTSW 8 25817614 missense possibly damaging 0.93
R6473:Ash2l UTSW 8 25834980 missense probably damaging 0.98
R6678:Ash2l UTSW 8 25833777 missense probably damaging 1.00
R6710:Ash2l UTSW 8 25819712 missense possibly damaging 0.63
R6954:Ash2l UTSW 8 25822768 missense possibly damaging 0.52
R7166:Ash2l UTSW 8 25827320 missense probably damaging 1.00
R7266:Ash2l UTSW 8 25827205 nonsense probably null
R7483:Ash2l UTSW 8 25822770 missense probably damaging 1.00
R7828:Ash2l UTSW 8 25823186 missense possibly damaging 0.91
R7962:Ash2l UTSW 8 25839764 missense probably damaging 0.96
R8084:Ash2l UTSW 8 25831294 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACTCAGAGTAAGTAGTTGTGTGG -3'
(R):5'- ATCTCACGTACCACCCTGTG -3'

Sequencing Primer
(F):5'- AGGCACTGCTGCAGTCC -3'
(R):5'- GTACCACCCTGTGAGTACTGTAAG -3'
Posted On2015-05-14