Incidental Mutation 'R4155:Ncan'
ID315089
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Nameneurocan
SynonymsCspg3, Cspg3-rs, neurocan, Tgfbit
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70093085-70120873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 70110077 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 510 (E510D)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002412
AA Change: E510D

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: E510D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70115271 missense probably benign 0.24
IGL00924:Ncan APN 8 70108389 missense possibly damaging 0.78
IGL01319:Ncan APN 8 70097562 missense probably damaging 0.99
IGL01407:Ncan APN 8 70101957 missense probably benign 0.17
IGL01528:Ncan APN 8 70110081 missense probably benign 0.00
IGL01567:Ncan APN 8 70108334 missense probably benign 0.09
IGL01808:Ncan APN 8 70107440 critical splice donor site probably null
IGL02543:Ncan APN 8 70108571 missense probably benign 0.37
IGL02551:Ncan APN 8 70102462 missense probably damaging 1.00
IGL02899:Ncan APN 8 70115048 missense possibly damaging 0.95
IGL02940:Ncan APN 8 70110085 missense probably benign 0.02
IGL03058:Ncan APN 8 70107932 missense possibly damaging 0.83
learned UTSW 8 70098081 nonsense probably null
sagacious UTSW 8 70112590 missense probably damaging 0.99
R0219:Ncan UTSW 8 70115334 missense probably benign 0.08
R0538:Ncan UTSW 8 70108602 missense possibly damaging 0.86
R0540:Ncan UTSW 8 70115159 missense possibly damaging 0.93
R0854:Ncan UTSW 8 70112552 missense probably damaging 1.00
R0918:Ncan UTSW 8 70108389 missense possibly damaging 0.78
R1344:Ncan UTSW 8 70108169 missense probably benign
R1575:Ncan UTSW 8 70110198 missense probably benign 0.27
R1739:Ncan UTSW 8 70108086 missense probably benign 0.03
R1847:Ncan UTSW 8 70102454 missense probably damaging 0.96
R1859:Ncan UTSW 8 70115348 missense possibly damaging 0.94
R2320:Ncan UTSW 8 70108218 missense probably benign
R2370:Ncan UTSW 8 70112813 missense probably benign 0.05
R3407:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3408:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3961:Ncan UTSW 8 70110300 missense probably benign 0.05
R4156:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4365:Ncan UTSW 8 70115211 missense probably damaging 1.00
R4858:Ncan UTSW 8 70104055 missense probably benign 0.00
R4925:Ncan UTSW 8 70109954 missense probably benign 0.02
R4942:Ncan UTSW 8 70100294 missense probably damaging 1.00
R4976:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5119:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5141:Ncan UTSW 8 70112837 missense probably damaging 1.00
R5679:Ncan UTSW 8 70112626 missense probably damaging 1.00
R5706:Ncan UTSW 8 70102017 missense probably damaging 0.99
R5915:Ncan UTSW 8 70098081 nonsense probably null
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6223:Ncan UTSW 8 70109954 missense probably benign 0.02
R6390:Ncan UTSW 8 70115249 missense probably benign 0.34
R6533:Ncan UTSW 8 70096357 missense probably benign 0.01
R6836:Ncan UTSW 8 70100315 missense possibly damaging 0.84
R6869:Ncan UTSW 8 70107907 missense probably benign 0.08
R7229:Ncan UTSW 8 70100311 missense possibly damaging 0.69
R7232:Ncan UTSW 8 70112088 missense probably damaging 1.00
R7293:Ncan UTSW 8 70115211 missense probably damaging 0.98
R7406:Ncan UTSW 8 70110099 missense probably benign 0.00
R7474:Ncan UTSW 8 70102041 missense possibly damaging 0.53
R7779:Ncan UTSW 8 70115011 missense probably damaging 0.99
R7973:Ncan UTSW 8 70097575 missense probably benign 0.00
R8113:Ncan UTSW 8 70108571 missense possibly damaging 0.58
R8269:Ncan UTSW 8 70107680 missense probably benign 0.01
Z1177:Ncan UTSW 8 70097472 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGGTTGCAGTCACCCTTTC -3'
(R):5'- AGACCCTTGGTTCTACTCCAG -3'

Sequencing Primer
(F):5'- GCAGTCACCCTTTCTCCTCAGG -3'
(R):5'- TGGCCCTCTTCAGAAAAGTG -3'
Posted On2015-05-14