Incidental Mutation 'R4155:Olfr933'
ID315091
Institutional Source Beutler Lab
Gene Symbol Olfr933
Ensembl Gene ENSMUSG00000058515
Gene Nameolfactory receptor 933
SynonymsGA_x6K02T2PVTD-32671531-32672457, MOR171-22
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38972313-38979861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38976155 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 160 (T160S)
Ref Sequence ENSEMBL: ENSMUSP00000149292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075680] [ENSMUST00000214324] [ENSMUST00000216238] [ENSMUST00000216823]
Predicted Effect probably damaging
Transcript: ENSMUST00000075680
AA Change: T160S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075102
Gene: ENSMUSG00000058515
AA Change: T160S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-50 PFAM
Pfam:7tm_1 41 290 3.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214324
Predicted Effect probably damaging
Transcript: ENSMUST00000216238
AA Change: T160S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000216823
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Olfr933
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Olfr933 APN 9 38976614 unclassified probably benign
IGL03057:Olfr933 APN 9 38976218 missense probably benign 0.04
R0225:Olfr933 UTSW 9 38976278 missense probably benign 0.00
R0234:Olfr933 UTSW 9 38976251 splice site probably null
R0234:Olfr933 UTSW 9 38976251 splice site probably null
R1479:Olfr933 UTSW 9 38975762 missense probably benign
R1710:Olfr933 UTSW 9 38975906 missense probably damaging 0.97
R1717:Olfr933 UTSW 9 38976410 missense probably damaging 1.00
R1865:Olfr933 UTSW 9 38975904 missense probably benign 0.01
R2258:Olfr933 UTSW 9 38976000 missense probably benign 0.02
R2259:Olfr933 UTSW 9 38976000 missense probably benign 0.02
R2260:Olfr933 UTSW 9 38976000 missense probably benign 0.02
R4299:Olfr933 UTSW 9 38975759 missense probably damaging 1.00
R4452:Olfr933 UTSW 9 38976086 missense probably benign 0.02
R5379:Olfr933 UTSW 9 38975855 missense possibly damaging 0.81
R6340:Olfr933 UTSW 9 38975766 missense probably damaging 1.00
R6497:Olfr933 UTSW 9 38976194 missense probably benign
R7039:Olfr933 UTSW 9 38975987 missense probably damaging 1.00
R7378:Olfr933 UTSW 9 38975721 missense probably benign
R7453:Olfr933 UTSW 9 38976204 missense probably damaging 1.00
R7732:Olfr933 UTSW 9 38976264 missense probably damaging 1.00
R7762:Olfr933 UTSW 9 38976194 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCTACTCAGAGTGCATGGC -3'
(R):5'- TGATGTGAAGGATGCTGCAG -3'

Sequencing Primer
(F):5'- AGAGTGCATGGCCCAGCTC -3'
(R):5'- TGAAGGATGCTGCAGAAAATAAAGAC -3'
Posted On2015-05-14