Incidental Mutation 'R4155:Bsx'
ID315092
Institutional Source Beutler Lab
Gene Symbol Bsx
Ensembl Gene ENSMUSG00000054360
Gene Namebrain specific homeobox
SynonymsBsx1a, Bsx1b
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4155 (G1)
Quality Score144
Status Not validated
Chromosome9
Chromosomal Location40874127-40880057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40876336 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 102 (E102G)
Ref Sequence ENSEMBL: ENSMUSP00000068057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067375]
Predicted Effect probably benign
Transcript: ENSMUST00000067375
AA Change: E102G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000068057
Gene: ENSMUSG00000054360
AA Change: E102G

DomainStartEndE-ValueType
low complexity region 57 81 N/A INTRINSIC
HOX 110 172 2.64e-26 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for mutations in Bsx display increased fat mass, decreased food intake after fasting, decreased body temperature, and reduced locomotor activity, but body weight and glucose homoeostasis are similar to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Bsx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Bsx APN 9 40874221 missense probably benign 0.00
IGL02510:Bsx APN 9 40874221 missense possibly damaging 0.49
IGL03295:Bsx APN 9 40874447 splice site probably benign
R0507:Bsx UTSW 9 40876500 splice site probably benign
R0686:Bsx UTSW 9 40876437 missense probably damaging 1.00
R3120:Bsx UTSW 9 40877612 missense possibly damaging 0.95
R5504:Bsx UTSW 9 40874164 start gained probably benign
R6328:Bsx UTSW 9 40874223 missense probably damaging 1.00
X0027:Bsx UTSW 9 40877773 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCGCTATTTTGTGGCTCC -3'
(R):5'- ACTACTTCAGAGTTGAGGAGGG -3'

Sequencing Primer
(F):5'- CCTCTTCCGGCTGTTATTGAGAG -3'
(R):5'- AGAATCCGGGGCATCCTC -3'
Posted On2015-05-14