Incidental Mutation 'R4155:Ccpg1'
ID315094
Institutional Source Beutler Lab
Gene Symbol Ccpg1
Ensembl Gene ENSMUSG00000034563
Gene Namecell cycle progression 1
Synonyms1700030B06Rik, D9Ertd392e, 1810073J13Rik, 9430028F23Rik
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location72985429-73016340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73012167 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 355 (Q355K)
Ref Sequence ENSEMBL: ENSMUSP00000122966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037977] [ENSMUST00000085350] [ENSMUST00000093819] [ENSMUST00000098566] [ENSMUST00000124008] [ENSMUST00000140675] [ENSMUST00000149692] [ENSMUST00000150826] [ENSMUST00000183746] [ENSMUST00000184035] [ENSMUST00000184389]
Predicted Effect probably benign
Transcript: ENSMUST00000037977
AA Change: Q355K

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045669
Gene: ENSMUSG00000034563
AA Change: Q355K

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085350
AA Change: Q355K

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082458
Gene: ENSMUSG00000034563
AA Change: Q355K

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093819
Predicted Effect probably benign
Transcript: ENSMUST00000098566
SMART Domains Protein: ENSMUSP00000096165
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 4.7e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124008
SMART Domains Protein: ENSMUSP00000121059
Gene: ENSMUSG00000034563

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138466
Predicted Effect probably benign
Transcript: ENSMUST00000140675
AA Change: Q355K

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116976
Gene: ENSMUSG00000034563
AA Change: Q355K

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149692
SMART Domains Protein: ENSMUSP00000120629
Gene: ENSMUSG00000089865

DomainStartEndE-ValueType
Pfam:CS 6 77 2.1e-9 PFAM
coiled coil region 101 161 N/A INTRINSIC
Pfam:TPR_11 286 352 2e-14 PFAM
Pfam:TPR_1 322 352 5.6e-6 PFAM
Blast:TPR 364 386 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150826
AA Change: Q355K

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122966
Gene: ENSMUSG00000034563
AA Change: Q355K

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183746
SMART Domains Protein: ENSMUSP00000138885
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184035
SMART Domains Protein: ENSMUSP00000139269
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184389
SMART Domains Protein: ENSMUSP00000139076
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Ccpg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01665:Ccpg1 APN 9 73005877 missense probably damaging 1.00
IGL01710:Ccpg1 APN 9 72997441 utr 3 prime probably benign
IGL01818:Ccpg1 APN 9 72997453 missense probably damaging 1.00
K7894:Ccpg1 UTSW 9 73001877 critical splice donor site probably null
R0586:Ccpg1 UTSW 9 73001821 missense probably benign 0.00
R1188:Ccpg1 UTSW 9 73012506 missense possibly damaging 0.55
R1503:Ccpg1 UTSW 9 72999478 missense probably benign 0.00
R1599:Ccpg1 UTSW 9 72999125 nonsense probably null
R2130:Ccpg1 UTSW 9 73013158 missense probably damaging 0.98
R2188:Ccpg1 UTSW 9 73013106 missense probably benign 0.00
R3052:Ccpg1 UTSW 9 73005868 missense probably damaging 1.00
R4156:Ccpg1 UTSW 9 73012167 missense probably benign 0.38
R4157:Ccpg1 UTSW 9 73012167 missense probably benign 0.38
R4257:Ccpg1 UTSW 9 73012627 missense probably damaging 1.00
R4677:Ccpg1 UTSW 9 73015915 intron probably benign
R5081:Ccpg1 UTSW 9 72999078 missense possibly damaging 0.94
R5227:Ccpg1 UTSW 9 73012072 nonsense probably null
R5288:Ccpg1 UTSW 9 73013044 missense probably benign
R5385:Ccpg1 UTSW 9 73013044 missense probably benign
R5386:Ccpg1 UTSW 9 73013044 missense probably benign
R5412:Ccpg1 UTSW 9 73010306 missense probably damaging 1.00
R5754:Ccpg1 UTSW 9 73013244 missense possibly damaging 0.78
R6230:Ccpg1 UTSW 9 73012356 missense probably benign 0.00
R7269:Ccpg1 UTSW 9 73013327 missense probably benign 0.06
R7287:Ccpg1 UTSW 9 73015406 missense probably benign 0.05
R7542:Ccpg1 UTSW 9 73012459 missense probably damaging 1.00
R7882:Ccpg1 UTSW 9 73015505 missense probably damaging 1.00
R8266:Ccpg1 UTSW 9 73005719 missense probably damaging 1.00
R8268:Ccpg1 UTSW 9 73005719 missense probably damaging 1.00
R8269:Ccpg1 UTSW 9 73005719 missense probably damaging 1.00
R8345:Ccpg1 UTSW 9 73005719 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTTGGACCGTTACTGAATCAG -3'
(R):5'- TCTGCACACTAGGAGACTCC -3'

Sequencing Primer
(F):5'- CCGTTACTGAATCAGAGAAGATTACC -3'
(R):5'- ACTAGGAGACTCCGCACG -3'
Posted On2015-05-14