Incidental Mutation 'R4155:Srgn'
ID315098
Institutional Source Beutler Lab
Gene Symbol Srgn
Ensembl Gene ENSMUSG00000020077
Gene Nameserglycin
SynonymsSgc, Prg1
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62493833-62527451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62497834 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 55 (F55L)
Ref Sequence ENSEMBL: ENSMUSP00000125533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020271] [ENSMUST00000160643] [ENSMUST00000160987] [ENSMUST00000162161]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020271
AA Change: F55L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020271
Gene: ENSMUSG00000020077
AA Change: F55L

DomainStartEndE-ValueType
Pfam:Serglycin 1 151 9e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160643
Predicted Effect possibly damaging
Transcript: ENSMUST00000160987
AA Change: F55L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125622
Gene: ENSMUSG00000020077
AA Change: F55L

DomainStartEndE-ValueType
Pfam:Serglycin 1 149 8.3e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162161
AA Change: F55L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125533
Gene: ENSMUSG00000020077
AA Change: F55L

DomainStartEndE-ValueType
Pfam:Serglycin 1 151 9e-75 PFAM
Meta Mutation Damage Score 0.6246 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene lack peritoneal mast cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Srgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB008:Srgn UTSW 10 62494984 missense possibly damaging 0.71
BB018:Srgn UTSW 10 62494984 missense possibly damaging 0.71
R2120:Srgn UTSW 10 62507634 splice site probably benign
R3704:Srgn UTSW 10 62497830 missense probably damaging 0.99
R4156:Srgn UTSW 10 62497834 missense possibly damaging 0.92
R4157:Srgn UTSW 10 62497834 missense possibly damaging 0.92
R4782:Srgn UTSW 10 62497852 missense possibly damaging 0.95
R5169:Srgn UTSW 10 62495087 missense probably damaging 1.00
R7595:Srgn UTSW 10 62508006 unclassified probably benign
R7645:Srgn UTSW 10 62494978 nonsense probably null
R7931:Srgn UTSW 10 62494984 missense possibly damaging 0.71
R8292:Srgn UTSW 10 62507668 missense possibly damaging 0.94
R8324:Srgn UTSW 10 62507665 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGTCCATGTTCATTGGCACATC -3'
(R):5'- TGCGACCTGCCAAATGTAC -3'

Sequencing Primer
(F):5'- ATTGGCACATCTCTTGCTTCAG -3'
(R):5'- CCATGTAATTACCTTGTTAGAGACAG -3'
Posted On2015-05-14