Incidental Mutation 'R4155:P2rx5'
ID315101
Institutional Source Beutler Lab
Gene Symbol P2rx5
Ensembl Gene ENSMUSG00000005950
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 5
SynonymsP2X5
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73160421-73172685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73171829 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 455 (T455A)
Ref Sequence ENSEMBL: ENSMUSP00000006104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006104] [ENSMUST00000054952] [ENSMUST00000108480] [ENSMUST00000135202] [ENSMUST00000136894]
Predicted Effect probably damaging
Transcript: ENSMUST00000006104
AA Change: T455A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000006104
Gene: ENSMUSG00000005950
AA Change: T455A

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 382 2.1e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054952
SMART Domains Protein: ENSMUSP00000060892
Gene: ENSMUSG00000047260

DomainStartEndE-ValueType
Pfam:Rab5ip 24 104 6.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108480
SMART Domains Protein: ENSMUSP00000104120
Gene: ENSMUSG00000047260

DomainStartEndE-ValueType
Pfam:Rab5ip 24 104 6.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135202
SMART Domains Protein: ENSMUSP00000118448
Gene: ENSMUSG00000005950

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 307 1.8e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136894
SMART Domains Protein: ENSMUSP00000121834
Gene: ENSMUSG00000005950

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 331 2.9e-144 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream gene, TAX1BP3 (Tax1 binding protein 3). [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous mutant mice exhibit decreased peripheral blood CD8+ lymphocytes and elevated NK cells. Impaired learning/memory during trace aversive conditioning and increased exploratory behavior during open field testing is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in P2rx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:P2rx5 APN 11 73167492 critical splice acceptor site probably null
IGL01860:P2rx5 APN 11 73165559 missense probably damaging 0.98
IGL02019:P2rx5 APN 11 73167977 splice site probably benign
IGL03079:P2rx5 APN 11 73164888 missense possibly damaging 0.92
IGL03088:P2rx5 APN 11 73165620 splice site probably benign
R0014:P2rx5 UTSW 11 73167062 splice site probably benign
R0845:P2rx5 UTSW 11 73165574 missense probably damaging 1.00
R1384:P2rx5 UTSW 11 73167890 missense probably damaging 1.00
R3415:P2rx5 UTSW 11 73160660 missense possibly damaging 0.94
R4641:P2rx5 UTSW 11 73167564 missense possibly damaging 0.58
R4750:P2rx5 UTSW 11 73164877 missense probably damaging 1.00
R4854:P2rx5 UTSW 11 73171779 missense probably benign 0.23
R5186:P2rx5 UTSW 11 73171790 missense possibly damaging 0.68
R7003:P2rx5 UTSW 11 73167974 critical splice donor site probably null
R7141:P2rx5 UTSW 11 73160648 missense probably damaging 1.00
R7312:P2rx5 UTSW 11 73164866 missense probably damaging 1.00
X0004:P2rx5 UTSW 11 73166989 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACACCGTCATGCATCTG -3'
(R):5'- AAGCCTTCCATGAAACAAATCTTGC -3'

Sequencing Primer
(F):5'- GCTGCAGCTAAGACAGTGTTC -3'
(R):5'- TTCCATGAAACAAATCTTGCAGCAGG -3'
Posted On2015-05-14