Incidental Mutation 'R4155:Zfp410'
ID315104
Institutional Source Beutler Lab
Gene Symbol Zfp410
Ensembl Gene ENSMUSG00000042472
Gene Namezinc finger protein 410
SynonymsD12Ertd748e
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location84316852-84343723 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84327432 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 181 (R181H)
Ref Sequence ENSEMBL: ENSMUSP00000152441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045931] [ENSMUST00000220931] [ENSMUST00000221656] [ENSMUST00000222258] [ENSMUST00000222471] [ENSMUST00000222606] [ENSMUST00000222832]
Predicted Effect probably damaging
Transcript: ENSMUST00000045931
AA Change: R181H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045550
Gene: ENSMUSG00000042472
AA Change: R181H

DomainStartEndE-ValueType
ZnF_C2H2 219 243 1.04e-3 SMART
ZnF_C2H2 249 273 6.88e-4 SMART
ZnF_C2H2 279 303 1.13e-4 SMART
ZnF_C2H2 309 333 1.45e-2 SMART
ZnF_C2H2 339 361 5.59e-4 SMART
low complexity region 400 417 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220931
AA Change: R181H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221490
Predicted Effect probably benign
Transcript: ENSMUST00000221656
Predicted Effect probably damaging
Transcript: ENSMUST00000222258
AA Change: R181H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222431
Predicted Effect probably benign
Transcript: ENSMUST00000222450
Predicted Effect probably benign
Transcript: ENSMUST00000222471
Predicted Effect probably benign
Transcript: ENSMUST00000222606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222773
Predicted Effect probably damaging
Transcript: ENSMUST00000222832
AA Change: R128H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222875
Meta Mutation Damage Score 0.6793 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Other mutations in Zfp410
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Zfp410 APN 12 84327274 splice site probably benign
IGL01871:Zfp410 APN 12 84325791 critical splice donor site probably null
IGL02152:Zfp410 APN 12 84332928 unclassified probably benign
IGL02702:Zfp410 APN 12 84325776 missense probably damaging 1.00
IGL02902:Zfp410 APN 12 84331820 splice site probably null
R0453:Zfp410 UTSW 12 84331712 missense probably damaging 0.99
R1525:Zfp410 UTSW 12 84322966 missense probably damaging 1.00
R1569:Zfp410 UTSW 12 84332952 missense probably damaging 1.00
R1694:Zfp410 UTSW 12 84325720 missense probably benign
R2263:Zfp410 UTSW 12 84323020 critical splice donor site probably null
R2878:Zfp410 UTSW 12 84331637 missense probably damaging 1.00
R3941:Zfp410 UTSW 12 84338753 missense probably damaging 1.00
R4156:Zfp410 UTSW 12 84327432 missense probably damaging 1.00
R4157:Zfp410 UTSW 12 84327432 missense probably damaging 1.00
R4630:Zfp410 UTSW 12 84325736 missense probably damaging 1.00
R4632:Zfp410 UTSW 12 84325736 missense probably damaging 1.00
R4633:Zfp410 UTSW 12 84325736 missense probably damaging 1.00
R4880:Zfp410 UTSW 12 84337675 missense probably damaging 0.97
R4969:Zfp410 UTSW 12 84331808 missense possibly damaging 0.89
R5893:Zfp410 UTSW 12 84337611 splice site probably null
R5981:Zfp410 UTSW 12 84331640 missense probably benign 0.17
R6268:Zfp410 UTSW 12 84331838 missense probably benign 0.02
R7318:Zfp410 UTSW 12 84325690 missense probably benign 0.00
R7599:Zfp410 UTSW 12 84331856 missense probably benign 0.00
R8357:Zfp410 UTSW 12 84327312 missense possibly damaging 0.94
R8457:Zfp410 UTSW 12 84327312 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTGTGCCTGGGCTAATCTC -3'
(R):5'- TGTATGTGCACACACCATACAC -3'

Sequencing Primer
(F):5'- GTGCCTGGGCTAATCTCCTACC -3'
(R):5'- GGCAATTCTACTAGGCTCCAC -3'
Posted On2015-05-14