Incidental Mutation 'R4155:Zfp410'
ID 315104
Institutional Source Beutler Lab
Gene Symbol Zfp410
Ensembl Gene ENSMUSG00000042472
Gene Name zinc finger protein 410
Synonyms D12Ertd748e
MMRRC Submission 040999-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.212) question?
Stock # R4155 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 84363626-84390497 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 84374206 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 181 (R181H)
Ref Sequence ENSEMBL: ENSMUSP00000152441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045931] [ENSMUST00000220931] [ENSMUST00000221656] [ENSMUST00000222258] [ENSMUST00000222832] [ENSMUST00000222606] [ENSMUST00000222471]
AlphaFold Q8BKX7
Predicted Effect probably damaging
Transcript: ENSMUST00000045931
AA Change: R181H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045550
Gene: ENSMUSG00000042472
AA Change: R181H

DomainStartEndE-ValueType
ZnF_C2H2 219 243 1.04e-3 SMART
ZnF_C2H2 249 273 6.88e-4 SMART
ZnF_C2H2 279 303 1.13e-4 SMART
ZnF_C2H2 309 333 1.45e-2 SMART
ZnF_C2H2 339 361 5.59e-4 SMART
low complexity region 400 417 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220931
AA Change: R181H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221490
Predicted Effect probably benign
Transcript: ENSMUST00000221656
Predicted Effect probably damaging
Transcript: ENSMUST00000222258
AA Change: R181H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000222832
AA Change: R128H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222773
Predicted Effect probably benign
Transcript: ENSMUST00000222450
Predicted Effect probably benign
Transcript: ENSMUST00000222606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222431
Predicted Effect probably benign
Transcript: ENSMUST00000222471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222875
Meta Mutation Damage Score 0.6793 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,644,018 (GRCm39) F69I possibly damaging Het
Akt3 A G 1: 176,924,543 (GRCm39) I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Armc2 A G 10: 41,887,863 (GRCm39) V40A probably damaging Het
Ash2l A G 8: 26,307,482 (GRCm39) Y485H probably damaging Het
Atr T A 9: 95,770,177 (GRCm39) C1202* probably null Het
Bcl11b A T 12: 107,883,684 (GRCm39) probably null Het
Birc6 C A 17: 74,903,934 (GRCm39) S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,162,652 (GRCm39) probably benign Het
Bsx A G 9: 40,787,632 (GRCm39) E102G probably benign Het
Casq2 A T 3: 102,040,418 (GRCm39) probably null Het
Ccpg1 C A 9: 72,919,449 (GRCm39) Q355K probably benign Het
Copa T G 1: 171,928,992 (GRCm39) N251K probably damaging Het
Cst8 C A 2: 148,641,996 (GRCm39) A31E possibly damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Ecd A G 14: 20,374,632 (GRCm39) S503P probably damaging Het
Fbn2 C A 18: 58,156,359 (GRCm39) E2487* probably null Het
Hoxd9 A G 2: 74,529,667 (GRCm39) I308V probably benign Het
Ica1l G A 1: 60,053,052 (GRCm39) A162V possibly damaging Het
Kcnj15 A T 16: 95,097,166 (GRCm39) K263* probably null Het
Mettl4 T C 17: 95,048,003 (GRCm39) M213V probably benign Het
Nalf1 T A 8: 9,283,023 (GRCm39) Y342F possibly damaging Het
Ncan C A 8: 70,562,727 (GRCm39) E510D possibly damaging Het
Ndufs4 A T 13: 114,444,390 (GRCm39) S129R probably benign Het
Or14a259 T A 7: 86,013,270 (GRCm39) I92L probably benign Het
Or4c127 A G 2: 89,833,004 (GRCm39) S85G probably benign Het
Or52s19 T C 7: 103,008,363 (GRCm39) T13A probably benign Het
Or8d1b A T 9: 38,887,451 (GRCm39) T160S probably damaging Het
P2rx5 A G 11: 73,062,655 (GRCm39) T455A probably damaging Het
Pcdh1 T A 18: 38,336,159 (GRCm39) T159S probably damaging Het
Poln A G 5: 34,166,993 (GRCm39) V755A possibly damaging Het
Pou4f1 C T 14: 104,705,153 (GRCm39) S6N possibly damaging Het
Rpap1 C T 2: 119,604,660 (GRCm39) R416H probably damaging Het
Samd4 T A 14: 47,290,403 (GRCm39) M170K possibly damaging Het
Srgn A G 10: 62,333,613 (GRCm39) F55L possibly damaging Het
Tmcc1 C T 6: 116,110,765 (GRCm39) G176D probably benign Het
Tmem232 A T 17: 65,743,328 (GRCm39) M321K probably damaging Het
Tnfsf11 A G 14: 78,537,309 (GRCm39) M118T probably benign Het
Tns1 T A 1: 73,953,790 (GRCm39) N1848Y probably damaging Het
Ttc27 T G 17: 75,147,455 (GRCm39) I669S probably benign Het
Uaca A G 9: 60,779,035 (GRCm39) S1141G probably benign Het
Usp34 T A 11: 23,367,676 (GRCm39) V1671E probably damaging Het
Wdr64 T A 1: 175,597,172 (GRCm39) L73H probably benign Het
Other mutations in Zfp410
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Zfp410 APN 12 84,374,048 (GRCm39) splice site probably benign
IGL01871:Zfp410 APN 12 84,372,565 (GRCm39) critical splice donor site probably null
IGL02152:Zfp410 APN 12 84,379,702 (GRCm39) unclassified probably benign
IGL02702:Zfp410 APN 12 84,372,550 (GRCm39) missense probably damaging 1.00
IGL02902:Zfp410 APN 12 84,378,594 (GRCm39) splice site probably null
R0453:Zfp410 UTSW 12 84,378,486 (GRCm39) missense probably damaging 0.99
R1525:Zfp410 UTSW 12 84,369,740 (GRCm39) missense probably damaging 1.00
R1569:Zfp410 UTSW 12 84,379,726 (GRCm39) missense probably damaging 1.00
R1694:Zfp410 UTSW 12 84,372,494 (GRCm39) missense probably benign
R2263:Zfp410 UTSW 12 84,369,794 (GRCm39) critical splice donor site probably null
R2878:Zfp410 UTSW 12 84,378,411 (GRCm39) missense probably damaging 1.00
R3941:Zfp410 UTSW 12 84,385,527 (GRCm39) missense probably damaging 1.00
R4156:Zfp410 UTSW 12 84,374,206 (GRCm39) missense probably damaging 1.00
R4157:Zfp410 UTSW 12 84,374,206 (GRCm39) missense probably damaging 1.00
R4630:Zfp410 UTSW 12 84,372,510 (GRCm39) missense probably damaging 1.00
R4632:Zfp410 UTSW 12 84,372,510 (GRCm39) missense probably damaging 1.00
R4633:Zfp410 UTSW 12 84,372,510 (GRCm39) missense probably damaging 1.00
R4880:Zfp410 UTSW 12 84,384,449 (GRCm39) missense probably damaging 0.97
R4969:Zfp410 UTSW 12 84,378,582 (GRCm39) missense possibly damaging 0.89
R5893:Zfp410 UTSW 12 84,384,385 (GRCm39) splice site probably null
R5981:Zfp410 UTSW 12 84,378,414 (GRCm39) missense probably benign 0.17
R6268:Zfp410 UTSW 12 84,378,612 (GRCm39) missense probably benign 0.02
R7318:Zfp410 UTSW 12 84,372,464 (GRCm39) missense probably benign 0.00
R7599:Zfp410 UTSW 12 84,378,630 (GRCm39) missense probably benign 0.00
R8357:Zfp410 UTSW 12 84,374,086 (GRCm39) missense possibly damaging 0.94
R8457:Zfp410 UTSW 12 84,374,086 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTGTGCCTGGGCTAATCTC -3'
(R):5'- TGTATGTGCACACACCATACAC -3'

Sequencing Primer
(F):5'- GTGCCTGGGCTAATCTCCTACC -3'
(R):5'- GGCAATTCTACTAGGCTCCAC -3'
Posted On 2015-05-14