Incidental Mutation 'R4155:Bcl11b'
ID315106
Institutional Source Beutler Lab
Gene Symbol Bcl11b
Ensembl Gene ENSMUSG00000048251
Gene NameB cell leukemia/lymphoma 11B
Synonyms9130430L19Rik, CTIP2, B630002E05Rik, COUP-TF interacting protein 2, Rit1
MMRRC Submission 040999-MU
Accession Numbers

Genbank: NM_001079883; MGI: 1929913

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4155 (G1)
Quality Score144
Status Not validated
Chromosome12
Chromosomal Location107910403-108003602 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 107917425 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066060] [ENSMUST00000066060] [ENSMUST00000109887] [ENSMUST00000109887] [ENSMUST00000109891] [ENSMUST00000109891]
Predicted Effect probably null
Transcript: ENSMUST00000066060
SMART Domains Protein: ENSMUSP00000068258
Gene: ENSMUSG00000048251

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
Blast:ZnF_C2H2 56 81 5e-10 BLAST
low complexity region 95 113 N/A INTRINSIC
ZnF_C2H2 221 244 1.16e-1 SMART
low complexity region 311 330 N/A INTRINSIC
ZnF_C2H2 426 448 6.23e-2 SMART
ZnF_C2H2 454 476 2.75e-3 SMART
low complexity region 519 551 N/A INTRINSIC
low complexity region 566 593 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 639 656 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 743 765 N/A INTRINSIC
ZnF_C2H2 786 808 1.41e0 SMART
ZnF_C2H2 814 836 4.24e-4 SMART
ZnF_C2H2 844 867 3.07e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000066060
SMART Domains Protein: ENSMUSP00000068258
Gene: ENSMUSG00000048251

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
Blast:ZnF_C2H2 56 81 5e-10 BLAST
low complexity region 95 113 N/A INTRINSIC
ZnF_C2H2 221 244 1.16e-1 SMART
low complexity region 311 330 N/A INTRINSIC
ZnF_C2H2 426 448 6.23e-2 SMART
ZnF_C2H2 454 476 2.75e-3 SMART
low complexity region 519 551 N/A INTRINSIC
low complexity region 566 593 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 639 656 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 743 765 N/A INTRINSIC
ZnF_C2H2 786 808 1.41e0 SMART
ZnF_C2H2 814 836 4.24e-4 SMART
ZnF_C2H2 844 867 3.07e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109887
SMART Domains Protein: ENSMUSP00000105513
Gene: ENSMUSG00000048251

DomainStartEndE-ValueType
ZnF_C2H2 27 50 1.16e-1 SMART
low complexity region 117 136 N/A INTRINSIC
ZnF_C2H2 232 254 6.23e-2 SMART
ZnF_C2H2 260 282 2.75e-3 SMART
low complexity region 325 357 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
low complexity region 423 442 N/A INTRINSIC
low complexity region 445 462 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
low complexity region 549 571 N/A INTRINSIC
ZnF_C2H2 592 614 1.41e0 SMART
ZnF_C2H2 620 642 4.24e-4 SMART
ZnF_C2H2 650 673 3.07e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109887
SMART Domains Protein: ENSMUSP00000105513
Gene: ENSMUSG00000048251

DomainStartEndE-ValueType
ZnF_C2H2 27 50 1.16e-1 SMART
low complexity region 117 136 N/A INTRINSIC
ZnF_C2H2 232 254 6.23e-2 SMART
ZnF_C2H2 260 282 2.75e-3 SMART
low complexity region 325 357 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
low complexity region 423 442 N/A INTRINSIC
low complexity region 445 462 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
low complexity region 549 571 N/A INTRINSIC
ZnF_C2H2 592 614 1.41e0 SMART
ZnF_C2H2 620 642 4.24e-4 SMART
ZnF_C2H2 650 673 3.07e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109891
SMART Domains Protein: ENSMUSP00000105517
Gene: ENSMUSG00000048251

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
Pfam:zf-C2H2_6 55 83 3.9e-9 PFAM
low complexity region 95 113 N/A INTRINSIC
ZnF_C2H2 149 172 1.16e-1 SMART
low complexity region 239 258 N/A INTRINSIC
ZnF_C2H2 354 376 6.23e-2 SMART
ZnF_C2H2 382 404 2.75e-3 SMART
low complexity region 447 479 N/A INTRINSIC
low complexity region 494 521 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 567 584 N/A INTRINSIC
low complexity region 587 603 N/A INTRINSIC
low complexity region 671 693 N/A INTRINSIC
ZnF_C2H2 714 736 1.41e0 SMART
ZnF_C2H2 742 764 4.24e-4 SMART
ZnF_C2H2 772 795 3.07e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109891
SMART Domains Protein: ENSMUSP00000105517
Gene: ENSMUSG00000048251

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
Pfam:zf-C2H2_6 55 83 3.9e-9 PFAM
low complexity region 95 113 N/A INTRINSIC
ZnF_C2H2 149 172 1.16e-1 SMART
low complexity region 239 258 N/A INTRINSIC
ZnF_C2H2 354 376 6.23e-2 SMART
ZnF_C2H2 382 404 2.75e-3 SMART
low complexity region 447 479 N/A INTRINSIC
low complexity region 494 521 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 567 584 N/A INTRINSIC
low complexity region 587 603 N/A INTRINSIC
low complexity region 671 693 N/A INTRINSIC
ZnF_C2H2 714 736 1.41e0 SMART
ZnF_C2H2 742 764 4.24e-4 SMART
ZnF_C2H2 772 795 3.07e-1 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein and is closely related to BCL11A, a gene whose translocation may be associated with B-cell malignancies. Although the specific function of this gene has not been determined, the encoded protein is known to be a transcriptional repressor, and is regulated by the NURD nucleosome remodeling and histone deacetylase complex. Four alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Animals homozygous for a mutation of this gene are born with open eyes, exhibit abnormalities of the thymus, and die within 1 day after birth. Mice heterozygous for a hypomorphic allele and a knock-out allele exhibit lethality at weaning due to maxillaryincisor hyperplasia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Bcl11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Bcl11b APN 12 107965815 missense possibly damaging 0.46
IGL02492:Bcl11b APN 12 107915686 missense probably damaging 0.98
IGL02559:Bcl11b APN 12 107915394 utr 3 prime probably benign
IGL02950:Bcl11b APN 12 107989806 missense probably benign 0.00
R0055:Bcl11b UTSW 12 107965777 missense probably benign 0.02
R0762:Bcl11b UTSW 12 107965663 intron probably benign
R1549:Bcl11b UTSW 12 107917163 missense probably damaging 0.97
R1682:Bcl11b UTSW 12 107916649 missense probably damaging 1.00
R2269:Bcl11b UTSW 12 107915651 missense possibly damaging 0.71
R2495:Bcl11b UTSW 12 107915447 missense possibly damaging 0.46
R3053:Bcl11b UTSW 12 107916001 missense probably benign 0.01
R4094:Bcl11b UTSW 12 107916835 missense probably damaging 1.00
R4095:Bcl11b UTSW 12 107916835 missense probably damaging 1.00
R4156:Bcl11b UTSW 12 107917425 splice site probably null
R4157:Bcl11b UTSW 12 107917425 splice site probably null
R4611:Bcl11b UTSW 12 107916530 missense probably damaging 0.97
R4900:Bcl11b UTSW 12 107989698 missense probably damaging 1.00
R4906:Bcl11b UTSW 12 107916709 missense probably damaging 1.00
R4982:Bcl11b UTSW 12 107965772 nonsense probably null
R5108:Bcl11b UTSW 12 107965726 missense probably benign 0.04
R5190:Bcl11b UTSW 12 107989716 missense probably damaging 1.00
R6380:Bcl11b UTSW 12 108003101 missense probably benign 0.20
R6423:Bcl11b UTSW 12 107915419 missense possibly damaging 0.82
R6792:Bcl11b UTSW 12 107989734 missense probably damaging 1.00
R7026:Bcl11b UTSW 12 107916592 missense probably damaging 0.99
R7074:Bcl11b UTSW 12 107989507 missense probably benign 0.01
R7371:Bcl11b UTSW 12 107989491 missense probably damaging 1.00
R7454:Bcl11b UTSW 12 107916208 missense possibly damaging 0.93
R7590:Bcl11b UTSW 12 108003143 start codon destroyed probably benign 0.21
R8005:Bcl11b UTSW 12 107916197 missense probably benign
X0018:Bcl11b UTSW 12 107989689 missense probably damaging 1.00
X0021:Bcl11b UTSW 12 107916877 missense probably damaging 0.97
Z1177:Bcl11b UTSW 12 107989740 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATTCATGAGTGGGGACTGCG -3'
(R):5'- TGCTCATAGATCCCGTGTTC -3'

Sequencing Primer
(F):5'- ACTGCGCCACGGTCTCC -3'
(R):5'- ATAGATCCCGTGTTCCCTTGC -3'
Posted On2015-05-14