Incidental Mutation 'R4155:Ecd'
ID315108
Institutional Source Beutler Lab
Gene Symbol Ecd
Ensembl Gene ENSMUSG00000021810
Gene Nameecdysoneless cell cycle regulator
Synonyms
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location20319852-20348121 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20324564 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 503 (S503P)
Ref Sequence ENSEMBL: ENSMUSP00000022344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022344]
Predicted Effect probably damaging
Transcript: ENSMUST00000022344
AA Change: S503P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022344
Gene: ENSMUSG00000021810
AA Change: S503P

DomainStartEndE-ValueType
Pfam:SGT1 14 597 4.4e-247 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality (no time point given). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Ecd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02171:Ecd APN 14 20320827 missense probably damaging 0.99
IGL02458:Ecd APN 14 20324477 missense probably benign 0.34
R0335:Ecd UTSW 14 20320734 missense probably benign
R0520:Ecd UTSW 14 20328664 missense probably benign 0.00
R1036:Ecd UTSW 14 20333318 unclassified probably benign
R1069:Ecd UTSW 14 20333436 missense probably damaging 1.00
R1315:Ecd UTSW 14 20337060 missense probably benign 0.16
R1478:Ecd UTSW 14 20346657 nonsense probably null
R1637:Ecd UTSW 14 20346692 missense probably damaging 1.00
R1891:Ecd UTSW 14 20338159 missense probably damaging 0.97
R2884:Ecd UTSW 14 20320773 missense probably damaging 1.00
R4156:Ecd UTSW 14 20324564 missense probably damaging 1.00
R4157:Ecd UTSW 14 20324564 missense probably damaging 1.00
R5026:Ecd UTSW 14 20337030 missense probably damaging 1.00
R5082:Ecd UTSW 14 20324368 splice site probably null
R5485:Ecd UTSW 14 20338205 missense probably benign 0.05
R5988:Ecd UTSW 14 20324561 missense probably damaging 1.00
R6126:Ecd UTSW 14 20338425 splice site probably null
R6136:Ecd UTSW 14 20320791 missense probably damaging 1.00
R7837:Ecd UTSW 14 20333332 missense probably damaging 1.00
R8052:Ecd UTSW 14 20329952 critical splice donor site probably null
R8432:Ecd UTSW 14 20320930 missense probably benign 0.00
R8438:Ecd UTSW 14 20338465 missense possibly damaging 0.90
Z1177:Ecd UTSW 14 20337019 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGGTGAAGCTTCTGCCCATG -3'
(R):5'- GTCCCTGAATTACTGTTTTGGGAAAG -3'

Sequencing Primer
(F):5'- GCTTCTGCCCATGCTGGTG -3'
(R):5'- CTGGCCTTGAACTCAGAGATCTG -3'
Posted On2015-05-14