Incidental Mutation 'R4155:Samd4'
ID315109
Institutional Source Beutler Lab
Gene Symbol Samd4
Ensembl Gene ENSMUSG00000021838
Gene Namesterile alpha motif domain containing 4
Synonyms4933436G17Rik, 1700024G08Rik, Smaug, 1700111L17Rik
MMRRC Submission 040999-MU
Accession Numbers

Genbank: NM_001037221, NM_028966, NM_001163433

Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location46882854-47105815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47052946 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 170 (M170K)
Ref Sequence ENSEMBL: ENSMUSP00000122833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022386] [ENSMUST00000100672] [ENSMUST00000125113] [ENSMUST00000137543] [ENSMUST00000228404]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022386
AA Change: M271K

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022386
Gene: ENSMUSG00000021838
AA Change: M271K

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
low complexity region 292 305 N/A INTRINSIC
SAM 320 383 1.4e-7 SMART
low complexity region 445 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100672
SMART Domains Protein: ENSMUSP00000098237
Gene: ENSMUSG00000021838

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
SAM 232 295 2.75e-6 SMART
low complexity region 357 375 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000125113
AA Change: M170K

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122833
Gene: ENSMUSG00000021838
AA Change: M170K

DomainStartEndE-ValueType
low complexity region 191 204 N/A INTRINSIC
SAM 219 282 1.4e-7 SMART
low complexity region 344 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137543
SMART Domains Protein: ENSMUSP00000114621
Gene: ENSMUSG00000021838

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
SAM 232 295 2.75e-6 SMART
low complexity region 357 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228404
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sterile alpha motifs (SAMs) in proteins such as SAMD4A are part of an RNA-binding domain that functions as a posttranscriptional regulator by binding to an RNA sequence motif known as the Smaug recognition element, which was named after the Drosophila Smaug protein (Baez and Boccaccio, 2005 [PubMed 16221671]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit leaness, myopathy and altered glucose metabolism. Mice homozygous for a spontaneous mutation exhibit kyphosis, abnormal gait, and decreased cortical bone thickness. [provided by MGI curators]
Allele List at MGI

ll alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Samd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Samd4 APN 14 47052898 missense probably damaging 1.00
IGL01413:Samd4 APN 14 47016792 missense probably benign 0.01
supermodel UTSW 14 47016337 missense probably damaging 1.00
B6584:Samd4 UTSW 14 47016337 missense probably damaging 1.00
G4846:Samd4 UTSW 14 47016319 missense probably damaging 1.00
R0096:Samd4 UTSW 14 47064297 missense possibly damaging 0.88
R0122:Samd4 UTSW 14 47016560 missense probably benign 0.44
R0562:Samd4 UTSW 14 47077509 missense probably damaging 1.00
R1247:Samd4 UTSW 14 47064328 critical splice donor site probably benign
R1247:Samd4 UTSW 14 47087758 small insertion probably benign
R1771:Samd4 UTSW 14 47089075 missense probably damaging 1.00
R1902:Samd4 UTSW 14 47074128 missense probably damaging 1.00
R1903:Samd4 UTSW 14 47074128 missense probably damaging 1.00
R2346:Samd4 UTSW 14 46884842 missense probably damaging 1.00
R4498:Samd4 UTSW 14 47096109 missense probably damaging 1.00
R4510:Samd4 UTSW 14 47077585 missense probably benign 0.05
R4511:Samd4 UTSW 14 47077585 missense probably benign 0.05
R4658:Samd4 UTSW 14 47064246 missense probably damaging 1.00
R4871:Samd4 UTSW 14 47066463 missense probably damaging 1.00
R4991:Samd4 UTSW 14 47074010 missense probably damaging 0.97
R5432:Samd4 UTSW 14 47074062 missense probably benign 0.09
R5687:Samd4 UTSW 14 47016565 missense probably benign
R6035:Samd4 UTSW 14 47087872 missense probably damaging 1.00
R6035:Samd4 UTSW 14 47087872 missense probably damaging 1.00
R6254:Samd4 UTSW 14 47016631 missense probably damaging 1.00
R6366:Samd4 UTSW 14 47074150 critical splice donor site probably null
R6376:Samd4 UTSW 14 47052962 missense probably damaging 1.00
R6944:Samd4 UTSW 14 47016635 missense possibly damaging 0.94
R7035:Samd4 UTSW 14 47089163 synonymous silent
R7148:Samd4 UTSW 14 47016683 missense probably benign 0.09
R7467:Samd4 UTSW 14 47087856 missense probably benign 0.19
R7999:Samd4 UTSW 14 47064247 missense probably damaging 0.99
R8301:Samd4 UTSW 14 47016678 missense probably benign
R8306:Samd4 UTSW 14 46884917 missense probably damaging 1.00
R8351:Samd4 UTSW 14 47101431 missense probably damaging 1.00
R8451:Samd4 UTSW 14 47101431 missense probably damaging 1.00
X0018:Samd4 UTSW 14 47016696 missense possibly damaging 0.94
X0022:Samd4 UTSW 14 47074017 missense probably benign 0.45
Z0001:Samd4 UTSW 14 47016337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATTCAGCCCACTATGCCAC -3'
(R):5'- GGTTCCTCATGTGGTCACTC -3'

Sequencing Primer
(F):5'- GCCCACTATGCCACCAGTG -3'
(R):5'- ATGTGGTCACTCACCTTTCATAC -3'
Posted On2015-05-14