Incidental Mutation 'R4155:Tnfsf11'
ID315110
Institutional Source Beutler Lab
Gene Symbol Tnfsf11
Ensembl Gene ENSMUSG00000022015
Gene Nametumor necrosis factor (ligand) superfamily, member 11
SynonymsOPGL, Ly109l, RANKL, ODF, Trance, OPGL, osteoclast differentiation factor
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location78277445-78308043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78299869 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 118 (M118T)
Ref Sequence ENSEMBL: ENSMUSP00000022592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022592]
PDB Structure
CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF MOUSE RANK LIGAND [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF TRANCE/RANKL CYTOKINE. [X-RAY DIFFRACTION]
Mouse RANKL Structure at 1.9A Resolution [X-RAY DIFFRACTION]
Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANKL-OPG complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000022592
AA Change: M118T

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022592
Gene: ENSMUSG00000022015
AA Change: M118T

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
transmembrane domain 49 71 N/A INTRINSIC
TNF 163 312 7.37e-58 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor (TNF) cytokine family which is a ligand for osteoprotegerin and functions as a key factor for osteoclast differentiation and activation. This protein was shown to be a dentritic cell survival factor and is involved in the regulation of T cell-dependent immune response. T cell activation was reported to induce expression of this gene and lead to an increase of osteoclastogenesis and bone loss. This protein was shown to activate antiapoptotic kinase AKT/PKB through a signaling complex involving SRC kinase and tumor necrosis factor receptor-associated factor (TRAF) 6, which indicated this protein may have a role in the regulation of cell apoptosis. Targeted disruption of the related gene in mice led to severe osteopetrosis and a lack of osteoclasts. The deficient mice exhibited defects in early differentiation of T and B lymphocytes, and failed to form lobulo-alveolar mammary structures during pregnancy. Two alternatively spliced transcript variants have been found. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit a failure of tooth eruption, osteopetrosis, failure to lactate and arrested alveolar bud differentiation during pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Tnfsf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02601:Tnfsf11 APN 14 78299945 nonsense probably null
R0352:Tnfsf11 UTSW 14 78278968 missense probably benign 0.17
R0377:Tnfsf11 UTSW 14 78299912 missense probably benign 0.00
R2062:Tnfsf11 UTSW 14 78278922 missense probably damaging 1.00
R2121:Tnfsf11 UTSW 14 78299893 missense probably benign 0.32
R2178:Tnfsf11 UTSW 14 78284242 missense probably benign 0.00
R2237:Tnfsf11 UTSW 14 78299981 missense possibly damaging 0.77
R2238:Tnfsf11 UTSW 14 78299981 missense possibly damaging 0.77
R2239:Tnfsf11 UTSW 14 78299981 missense possibly damaging 0.77
R2430:Tnfsf11 UTSW 14 78284312 missense probably benign 0.00
R4197:Tnfsf11 UTSW 14 78284312 missense probably benign 0.00
R4562:Tnfsf11 UTSW 14 78278580 missense probably damaging 1.00
R6141:Tnfsf11 UTSW 14 78307859 missense probably damaging 0.99
R8063:Tnfsf11 UTSW 14 78278658 missense probably damaging 1.00
X0020:Tnfsf11 UTSW 14 78278877 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATACCCGTGTCGCACATC -3'
(R):5'- GTCACAGTTCATTAACTATAACCCC -3'

Sequencing Primer
(F):5'- CCACATGGTTGGGAACTGATTC -3'
(R):5'- ACTATAACCCCTTTCATATCCTTTCC -3'
Posted On2015-05-14