Incidental Mutation 'R4155:Kcnj15'
ID315112
Institutional Source Beutler Lab
Gene Symbol Kcnj15
Ensembl Gene ENSMUSG00000062609
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 15
SynonymsKir4.2, IRKK, 4930414N08Rik
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location95257558-95300260 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 95296307 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 263 (K263*)
Ref Sequence ENSEMBL: ENSMUSP00000109493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037154] [ENSMUST00000113854] [ENSMUST00000113855] [ENSMUST00000113856] [ENSMUST00000113858] [ENSMUST00000113859] [ENSMUST00000113861] [ENSMUST00000113862] [ENSMUST00000125847] [ENSMUST00000134166] [ENSMUST00000138329] [ENSMUST00000140222] [ENSMUST00000152516]
Predicted Effect probably null
Transcript: ENSMUST00000037154
AA Change: K263*
SMART Domains Protein: ENSMUSP00000045218
Gene: ENSMUSG00000062609
AA Change: K263*

DomainStartEndE-ValueType
Pfam:IRK 57 384 4.4e-139 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113854
AA Change: K236*
SMART Domains Protein: ENSMUSP00000109485
Gene: ENSMUSG00000062609
AA Change: K236*

DomainStartEndE-ValueType
Pfam:IRK 30 365 2.5e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113855
AA Change: K236*
SMART Domains Protein: ENSMUSP00000109486
Gene: ENSMUSG00000062609
AA Change: K236*

DomainStartEndE-ValueType
Pfam:IRK 30 365 2.5e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113856
AA Change: K236*
SMART Domains Protein: ENSMUSP00000109487
Gene: ENSMUSG00000062609
AA Change: K236*

DomainStartEndE-ValueType
Pfam:IRK 30 365 2.5e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113858
AA Change: K236*
SMART Domains Protein: ENSMUSP00000109489
Gene: ENSMUSG00000062609
AA Change: K236*

DomainStartEndE-ValueType
Pfam:IRK 57 392 4.9e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113859
AA Change: K263*
SMART Domains Protein: ENSMUSP00000109490
Gene: ENSMUSG00000062609
AA Change: K263*

DomainStartEndE-ValueType
Pfam:IRK 57 392 4.9e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113861
AA Change: K263*
SMART Domains Protein: ENSMUSP00000109492
Gene: ENSMUSG00000062609
AA Change: K263*

DomainStartEndE-ValueType
Pfam:IRK 57 392 4.9e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113862
AA Change: K263*
SMART Domains Protein: ENSMUSP00000109493
Gene: ENSMUSG00000062609
AA Change: K263*

DomainStartEndE-ValueType
Pfam:IRK 57 392 4.9e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125847
Predicted Effect probably benign
Transcript: ENSMUST00000134166
SMART Domains Protein: ENSMUSP00000118992
Gene: ENSMUSG00000062609

DomainStartEndE-ValueType
Pfam:IRK 57 173 8.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138329
Predicted Effect probably benign
Transcript: ENSMUST00000140222
Predicted Effect probably benign
Transcript: ENSMUST00000152516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232605
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Eight transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous knockout mice exhibited impaired balance/coordination in a high-throughput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Kcnj15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Kcnj15 APN 16 95296463 missense probably damaging 1.00
IGL03096:Kcnj15 APN 16 95296434 missense probably damaging 1.00
R1117:Kcnj15 UTSW 16 95295625 missense probably benign 0.28
R3911:Kcnj15 UTSW 16 95296470 missense probably damaging 1.00
R3913:Kcnj15 UTSW 16 95296470 missense probably damaging 1.00
R3928:Kcnj15 UTSW 16 95296509 missense possibly damaging 0.95
R4613:Kcnj15 UTSW 16 95295794 missense probably damaging 1.00
R5334:Kcnj15 UTSW 16 95296649 missense probably damaging 1.00
R6151:Kcnj15 UTSW 16 95295668 nonsense probably null
R6334:Kcnj15 UTSW 16 95296236 missense probably damaging 1.00
R6446:Kcnj15 UTSW 16 95296259 missense probably benign 0.00
R6727:Kcnj15 UTSW 16 95296334 missense probably damaging 1.00
R7070:Kcnj15 UTSW 16 95295831 missense probably damaging 1.00
Z1088:Kcnj15 UTSW 16 95296119 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGAGCCGAGACCATTAAG -3'
(R):5'- TAGATCTCCTCCGGGATGTAAGAC -3'

Sequencing Primer
(F):5'- GAGACCATTAAGTTCAGCCACTGTG -3'
(R):5'- CTCCGGGATGTAAGACGTTCG -3'
Posted On2015-05-14