Incidental Mutation 'R4155:Ttc27'
ID315115
Institutional Source Beutler Lab
Gene Symbol Ttc27
Ensembl Gene ENSMUSG00000024078
Gene Nametetratricopeptide repeat domain 27
Synonyms2610511O17Rik
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R4155 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location74717750-74863570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 74840460 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 669 (I669S)
Ref Sequence ENSEMBL: ENSMUSP00000024882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024882]
Predicted Effect probably benign
Transcript: ENSMUST00000024882
AA Change: I669S

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000024882
Gene: ENSMUSG00000024078
AA Change: I669S

DomainStartEndE-ValueType
TPR 531 564 7.34e-3 SMART
TPR 565 598 5.56e-3 SMART
TPR 599 632 3.81e-1 SMART
Blast:TPR 633 666 7e-15 BLAST
coiled coil region 817 847 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Ttc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ttc27 APN 17 74780816 missense probably damaging 1.00
IGL01508:Ttc27 APN 17 74835357 missense probably damaging 0.98
IGL02010:Ttc27 APN 17 74780911 splice site probably benign
IGL02189:Ttc27 APN 17 74729899 missense probably damaging 0.99
IGL02487:Ttc27 APN 17 74856554 missense probably damaging 1.00
IGL02745:Ttc27 APN 17 74739733 missense probably benign 0.37
IGL02816:Ttc27 APN 17 74747774 splice site probably benign
IGL03389:Ttc27 APN 17 74858033 missense probably benign 0.00
R0024:Ttc27 UTSW 17 74770264 missense possibly damaging 0.79
R0511:Ttc27 UTSW 17 74718715 missense probably benign 0.22
R0518:Ttc27 UTSW 17 74856549 missense possibly damaging 0.80
R0521:Ttc27 UTSW 17 74856549 missense possibly damaging 0.80
R0633:Ttc27 UTSW 17 74729977 missense probably benign 0.02
R1415:Ttc27 UTSW 17 74739672 missense probably benign
R1597:Ttc27 UTSW 17 74863407 missense possibly damaging 0.95
R1961:Ttc27 UTSW 17 74780856 missense probably damaging 0.99
R2038:Ttc27 UTSW 17 74856502 missense probably benign 0.00
R3012:Ttc27 UTSW 17 74840459 missense probably benign 0.17
R3619:Ttc27 UTSW 17 74751128 splice site probably null
R4272:Ttc27 UTSW 17 74840360 missense probably damaging 1.00
R4291:Ttc27 UTSW 17 74856479 missense probably damaging 1.00
R4557:Ttc27 UTSW 17 74829549 missense probably benign 0.00
R5068:Ttc27 UTSW 17 74799342 missense probably damaging 1.00
R5069:Ttc27 UTSW 17 74799342 missense probably damaging 1.00
R5070:Ttc27 UTSW 17 74799342 missense probably damaging 1.00
R5074:Ttc27 UTSW 17 74747755 missense probably damaging 1.00
R5169:Ttc27 UTSW 17 74747695 nonsense probably null
R5203:Ttc27 UTSW 17 74777654 missense probably damaging 1.00
R5272:Ttc27 UTSW 17 74742977 missense probably damaging 1.00
R6260:Ttc27 UTSW 17 74858091 missense probably damaging 0.99
R6797:Ttc27 UTSW 17 74729888 missense probably benign 0.28
R6830:Ttc27 UTSW 17 74856555 nonsense probably null
R6987:Ttc27 UTSW 17 74777741 critical splice donor site probably null
R7121:Ttc27 UTSW 17 74747715 missense probably benign 0.04
R7393:Ttc27 UTSW 17 74770264 missense possibly damaging 0.79
R7543:Ttc27 UTSW 17 74717750 start gained probably benign
R7635:Ttc27 UTSW 17 74718715 missense probably benign 0.22
R8231:Ttc27 UTSW 17 74717964 missense probably benign 0.19
R8365:Ttc27 UTSW 17 74747674 missense probably damaging 1.00
X0026:Ttc27 UTSW 17 74856437 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CCTTCCTCAGAGTCAAAGCTTTTAG -3'
(R):5'- CGTAAGTCAGAGTGGCATACC -3'

Sequencing Primer
(F):5'- GCTTTTAGAACGTTACAAGAAGCCC -3'
(R):5'- CAGCAATACTGTATGTGATGGCACC -3'
Posted On2015-05-14