Incidental Mutation 'R4117:Rufy4'
ID315120
Institutional Source Beutler Lab
Gene Symbol Rufy4
Ensembl Gene ENSMUSG00000061815
Gene NameRUN and FYVE domain containing 4
Synonyms
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74125541-74148223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74147663 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 537 (C537R)
Ref Sequence ENSEMBL: ENSMUSP00000115873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080167] [ENSMUST00000127134]
Predicted Effect probably damaging
Transcript: ENSMUST00000080167
AA Change: C453R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079062
Gene: ENSMUSG00000061815
AA Change: C453R

DomainStartEndE-ValueType
Pfam:RUN 2 81 1.5e-8 PFAM
coiled coil region 331 404 N/A INTRINSIC
Blast:FYVE 415 472 2e-6 BLAST
SCOP:d1vfya_ 428 473 4e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127134
AA Change: C537R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115873
Gene: ENSMUSG00000061815
AA Change: C537R

DomainStartEndE-ValueType
Pfam:RUN 41 165 6.2e-10 PFAM
coiled coil region 415 488 N/A INTRINSIC
Blast:FYVE 499 556 2e-6 BLAST
SCOP:d1vfya_ 512 557 3e-7 SMART
Meta Mutation Damage Score 0.8605 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Rufy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Rufy4 APN 1 74129354 missense probably damaging 1.00
IGL02075:Rufy4 APN 1 74129359 missense probably damaging 1.00
IGL02604:Rufy4 APN 1 74134189 missense probably damaging 1.00
IGL02606:Rufy4 APN 1 74133350 splice site probably benign
IGL02928:Rufy4 APN 1 74129082 unclassified probably benign
R0091:Rufy4 UTSW 1 74128936 unclassified probably benign
R0507:Rufy4 UTSW 1 74146716 missense probably benign 0.02
R0589:Rufy4 UTSW 1 74132883 missense probably damaging 1.00
R0595:Rufy4 UTSW 1 74140930 missense possibly damaging 0.94
R0742:Rufy4 UTSW 1 74146716 missense probably benign 0.02
R1533:Rufy4 UTSW 1 74129843 critical splice donor site probably null
R1666:Rufy4 UTSW 1 74147678 missense probably benign 0.06
R1668:Rufy4 UTSW 1 74147678 missense probably benign 0.06
R1827:Rufy4 UTSW 1 74134120 missense probably damaging 1.00
R2018:Rufy4 UTSW 1 74140947 missense possibly damaging 0.49
R2095:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2306:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2307:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2472:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2475:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3022:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3054:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3055:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3056:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3117:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3118:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3236:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3237:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3545:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3546:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3547:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3548:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3767:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3768:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3770:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3816:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3817:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3818:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3819:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3895:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4050:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4091:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4124:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4125:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4127:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4231:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4233:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4234:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4236:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4254:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4255:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4319:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4320:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4321:Rufy4 UTSW 1 74132784 missense possibly damaging 0.93
R4321:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4322:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4323:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4324:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4360:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4361:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4406:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4408:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4516:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4517:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4520:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4522:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4524:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4531:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4533:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4617:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4661:Rufy4 UTSW 1 74133107 missense probably damaging 0.99
R4778:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4779:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4840:Rufy4 UTSW 1 74129039 missense possibly damaging 0.82
R4897:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4898:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4899:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4915:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4917:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4918:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4997:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5092:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5097:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5189:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5191:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5195:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5196:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5197:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5226:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5227:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5228:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5230:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5372:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5373:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5374:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5375:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5376:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5377:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5378:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5699:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5748:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5750:Rufy4 UTSW 1 74132909 missense probably benign 0.01
R5767:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5865:Rufy4 UTSW 1 74146755 missense probably damaging 0.99
R6083:Rufy4 UTSW 1 74129397 missense probably damaging 0.99
R6149:Rufy4 UTSW 1 74147733 missense probably benign 0.15
R6279:Rufy4 UTSW 1 74133224 missense probably benign 0.00
R6300:Rufy4 UTSW 1 74133224 missense probably benign 0.00
R6629:Rufy4 UTSW 1 74132367 intron probably null
R6809:Rufy4 UTSW 1 74133047 missense probably benign 0.00
R7179:Rufy4 UTSW 1 74132876 missense probably benign 0.12
R7218:Rufy4 UTSW 1 74133015 missense probably damaging 0.99
R7453:Rufy4 UTSW 1 74129334 splice site probably null
X0023:Rufy4 UTSW 1 74141049 missense probably benign 0.04
X0025:Rufy4 UTSW 1 74133019 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGCCATCAGGAGAAGCTG -3'
(R):5'- TAGGCCTATCTGTGGACTGC -3'

Sequencing Primer
(F):5'- GGAGAAGCTGCCACCTCAATTAG -3'
(R):5'- TGGACTGCCAGCTGTTCC -3'
Posted On2015-05-14