Incidental Mutation 'R4117:Acss2'
ID315122
Institutional Source Beutler Lab
Gene Symbol Acss2
Ensembl Gene ENSMUSG00000027605
Gene Nameacyl-CoA synthetase short-chain family member 2
SynonymsAcas1, acetyl-CoA synthetase 1, Acas2, AceCS1, ACAS, Acs1
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155517948-155585724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155556393 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 358 (F358L)
Ref Sequence ENSEMBL: ENSMUSP00000099431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029135] [ENSMUST00000065973] [ENSMUST00000103142] [ENSMUST00000133654]
Predicted Effect probably damaging
Transcript: ENSMUST00000029135
AA Change: F345L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029135
Gene: ENSMUSG00000027605
AA Change: F345L

DomainStartEndE-ValueType
Pfam:AMP-binding 108 575 1.9e-96 PFAM
Pfam:AMP-binding_C 583 661 2.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065973
AA Change: F345L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068776
Gene: ENSMUSG00000027605
AA Change: F345L

DomainStartEndE-ValueType
Pfam:AMP-binding 108 575 4.8e-98 PFAM
Pfam:AMP-binding_C 583 660 3.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103142
AA Change: F358L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099431
Gene: ENSMUSG00000027605
AA Change: F358L

DomainStartEndE-ValueType
Pfam:ACAS_N 47 107 8.1e-21 PFAM
Pfam:AMP-binding 108 588 4.7e-97 PFAM
Pfam:AMP-binding_C 596 674 1.3e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131054
Predicted Effect probably benign
Transcript: ENSMUST00000133654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148685
Predicted Effect probably benign
Transcript: ENSMUST00000151781
SMART Domains Protein: ENSMUSP00000122545
Gene: ENSMUSG00000027605

DomainStartEndE-ValueType
Pfam:AMP-binding 1 187 1.2e-32 PFAM
Pfam:AMP-binding 187 292 1.2e-15 PFAM
Meta Mutation Damage Score 0.8718 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme that catalyzes the activation of acetate for use in lipid synthesis and energy generation. The protein acts as a monomer and produces acetyl-CoA from acetate in a reaction that requires ATP. Expression of this gene is regulated by sterol regulatory element-binding proteins, transcription factors that activate genes required for the synthesis of cholesterol and unsaturated fatty acids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Acss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Acss2 APN 2 155562037 missense possibly damaging 0.83
IGL02333:Acss2 APN 2 155555884 missense probably damaging 1.00
IGL03278:Acss2 APN 2 155562001 missense possibly damaging 0.64
IGL03392:Acss2 APN 2 155562011 missense probably damaging 1.00
R1159:Acss2 UTSW 2 155551218 missense probably benign
R1293:Acss2 UTSW 2 155551221 missense probably benign
R1639:Acss2 UTSW 2 155556908 missense probably benign 0.01
R1725:Acss2 UTSW 2 155556844 missense possibly damaging 0.56
R1834:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R1835:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R1836:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R2361:Acss2 UTSW 2 155558669 missense probably damaging 0.98
R3899:Acss2 UTSW 2 155557237 splice site probably benign
R4008:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4009:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4010:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4011:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4031:Acss2 UTSW 2 155557210 missense probably damaging 1.00
R4515:Acss2 UTSW 2 155556363 missense probably benign 0.39
R4756:Acss2 UTSW 2 155561143 missense probably damaging 1.00
R4895:Acss2 UTSW 2 155550481 splice site probably benign
R5327:Acss2 UTSW 2 155573229 missense probably null
R5654:Acss2 UTSW 2 155574655 unclassified probably benign
R5717:Acss2 UTSW 2 155561153 missense probably damaging 1.00
R5743:Acss2 UTSW 2 155574616 unclassified probably benign
R5773:Acss2 UTSW 2 155574694 splice site probably null
R5825:Acss2 UTSW 2 155549178 unclassified probably null
R5979:Acss2 UTSW 2 155522109 missense possibly damaging 0.75
R6525:Acss2 UTSW 2 155550417 missense probably benign
R6551:Acss2 UTSW 2 155551208 missense probably benign
R6785:Acss2 UTSW 2 155560685 missense probably damaging 1.00
R6976:Acss2 UTSW 2 155556009 intron probably null
R7074:Acss2 UTSW 2 155522041 missense possibly damaging 0.94
R7372:Acss2 UTSW 2 155557180 missense probably damaging 0.99
R7448:Acss2 UTSW 2 155518266 missense probably damaging 1.00
R7528:Acss2 UTSW 2 155557146 missense probably damaging 1.00
R7541:Acss2 UTSW 2 155574690 critical splice donor site probably null
R7543:Acss2 UTSW 2 155549835 missense probably damaging 0.98
R7754:Acss2 UTSW 2 155561166 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTATGTGACATCAGGGTGTG -3'
(R):5'- AGCTTTGGGAAATGGTCACC -3'

Sequencing Primer
(F):5'- CAGATGCTGTGAAAGGGCATTG -3'
(R):5'- CCAGGAGAATTTTGTCTATGCCCAG -3'
Posted On2015-05-14