Incidental Mutation 'R4117:Fam210b'
ID315123
Institutional Source Beutler Lab
Gene Symbol Fam210b
Ensembl Gene ENSMUSG00000027495
Gene Namefamily with sequence similarity 210, member B
Synonyms
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location172345565-172355749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172351566 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 100 (S100P)
Ref Sequence ENSEMBL: ENSMUSP00000028995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028995] [ENSMUST00000028997] [ENSMUST00000109139] [ENSMUST00000109140]
Predicted Effect probably benign
Transcript: ENSMUST00000028995
AA Change: S100P

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028995
Gene: ENSMUSG00000027495
AA Change: S100P

DomainStartEndE-ValueType
Pfam:DUF1279 85 172 4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028997
SMART Domains Protein: ENSMUSP00000028997
Gene: ENSMUSG00000027496

DomainStartEndE-ValueType
S_TKc 146 396 2.25e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109139
SMART Domains Protein: ENSMUSP00000104767
Gene: ENSMUSG00000027496

DomainStartEndE-ValueType
S_TKc 124 374 2.25e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109140
SMART Domains Protein: ENSMUSP00000104768
Gene: ENSMUSG00000027496

DomainStartEndE-ValueType
S_TKc 124 374 2.25e-99 SMART
Meta Mutation Damage Score 0.2476 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Fam210b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Fam210b APN 2 172351540 missense probably damaging 0.99
IGL02142:Fam210b APN 2 172352577 unclassified probably benign
IGL02152:Fam210b APN 2 172351503 missense probably benign 0.02
IGL02531:Fam210b APN 2 172352755 missense probably damaging 0.99
IGL03051:Fam210b APN 2 172352692 missense probably benign 0.21
R0597:Fam210b UTSW 2 172345853 splice site probably benign
R4281:Fam210b UTSW 2 172351548 missense probably damaging 0.98
R4978:Fam210b UTSW 2 172345665 missense probably damaging 0.99
R4983:Fam210b UTSW 2 172345665 missense probably damaging 0.99
R5150:Fam210b UTSW 2 172351548 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAGATAAGGATAAAGGCCGGT -3'
(R):5'- CACACATTAGCTTAGCTTACAGC -3'

Sequencing Primer
(F):5'- GGTGGCAGCTACCAACCTAAC -3'
(R):5'- TGGGCAAGTGATTCTACCGAC -3'
Posted On2015-05-14