Incidental Mutation 'R4117:She'
ID315125
Institutional Source Beutler Lab
Gene Symbol She
Ensembl Gene ENSMUSG00000046280
Gene Namesrc homology 2 domain-containing transforming protein E
Synonyms
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89831370-89858834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89852372 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 394 (Y394F)
Ref Sequence ENSEMBL: ENSMUSP00000059658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050401]
Predicted Effect probably damaging
Transcript: ENSMUST00000050401
AA Change: Y394F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059658
Gene: ENSMUSG00000046280
AA Change: Y394F

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 167 184 N/A INTRINSIC
SH2 391 475 6.63e-24 SMART
Meta Mutation Damage Score 0.3051 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in She
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02578:She APN 3 89832066 missense probably damaging 0.99
R0926:She UTSW 3 89851594 splice site probably benign
R1563:She UTSW 3 89854614 missense probably benign 0.00
R1564:She UTSW 3 89849614 missense possibly damaging 0.81
R1776:She UTSW 3 89832038 missense possibly damaging 0.90
R1952:She UTSW 3 89849485 missense possibly damaging 0.63
R2881:She UTSW 3 89831924 missense probably benign 0.02
R4838:She UTSW 3 89851639 missense probably benign 0.05
R4960:She UTSW 3 89834237 missense possibly damaging 0.90
R5281:She UTSW 3 89849581 missense probably benign
R5491:She UTSW 3 89831790 missense probably damaging 0.99
R7422:She UTSW 3 89854557 missense possibly damaging 0.67
R7576:She UTSW 3 89831612 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGACTACTAGAATGGGCGTTG -3'
(R):5'- AGACCCGCCTTCAAATTTTACTTG -3'

Sequencing Primer
(F):5'- GTATCTGTTCTGAACATGAGTCAG -3'
(R):5'- CCCCAGGGAGGAAAGCC -3'
Posted On2015-05-14