Incidental Mutation 'R4117:Stx17'
ID315126
Institutional Source Beutler Lab
Gene Symbol Stx17
Ensembl Gene ENSMUSG00000061455
Gene Namesyntaxin 17
Synonyms9030425C21Rik, 6330411F21Rik, 4833418L03Rik
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location48124915-48186507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48180689 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 178 (D178G)
Ref Sequence ENSEMBL: ENSMUSP00000103349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064765] [ENSMUST00000107720] [ENSMUST00000107721]
Predicted Effect probably damaging
Transcript: ENSMUST00000064765
AA Change: D200G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068087
Gene: ENSMUSG00000061455
AA Change: D200G

DomainStartEndE-ValueType
low complexity region 74 88 N/A INTRINSIC
t_SNARE 156 223 9.65e-13 SMART
transmembrane domain 228 250 N/A INTRINSIC
transmembrane domain 255 274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107720
AA Change: D200G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103348
Gene: ENSMUSG00000061455
AA Change: D200G

DomainStartEndE-ValueType
low complexity region 74 88 N/A INTRINSIC
t_SNARE 156 223 9.65e-13 SMART
transmembrane domain 228 250 N/A INTRINSIC
transmembrane domain 255 274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107721
AA Change: D178G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103349
Gene: ENSMUSG00000061455
AA Change: D178G

DomainStartEndE-ValueType
low complexity region 52 66 N/A INTRINSIC
t_SNARE 134 201 9.65e-13 SMART
Meta Mutation Damage Score 0.6696 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Stx17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stx17 APN 4 48158955 missense possibly damaging 0.72
IGL01625:Stx17 APN 4 48181526 missense probably damaging 1.00
IGL01975:Stx17 APN 4 48180670 missense probably damaging 1.00
R1977:Stx17 UTSW 4 48181553 missense probably benign 0.00
R2069:Stx17 UTSW 4 48158870 missense probably damaging 0.99
R4201:Stx17 UTSW 4 48158870 missense probably damaging 0.99
R4202:Stx17 UTSW 4 48158870 missense probably damaging 0.99
R5265:Stx17 UTSW 4 48183470 utr 3 prime probably benign
R5308:Stx17 UTSW 4 48182851 utr 3 prime probably benign
R6414:Stx17 UTSW 4 48158809 critical splice acceptor site probably null
R6499:Stx17 UTSW 4 48183478 critical splice donor site probably null
R6969:Stx17 UTSW 4 48140462 missense probably damaging 1.00
R7062:Stx17 UTSW 4 48140442 missense probably benign 0.07
R7482:Stx17 UTSW 4 48181722 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTTTGCTCTGAAGGTGCCTC -3'
(R):5'- TGGTTCCCTCAACACTGAAG -3'

Sequencing Primer
(F):5'- CCTGAAAGTGAATTTGTACTTTCGAC -3'
(R):5'- GTTCCCTCAACACTGAAGAGAGC -3'
Posted On2015-05-14