Incidental Mutation 'R4117:Ubxn10'
ID315127
Institutional Source Beutler Lab
Gene Symbol Ubxn10
Ensembl Gene ENSMUSG00000043621
Gene NameUBX domain protein 10
Synonyms5730509E04Rik, Ubxd3
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location138709837-138737167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 138720965 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 133 (D133E)
Ref Sequence ENSEMBL: ENSMUSP00000117219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030530] [ENSMUST00000105808] [ENSMUST00000105809] [ENSMUST00000105810] [ENSMUST00000105811] [ENSMUST00000124660] [ENSMUST00000146415]
Predicted Effect probably benign
Transcript: ENSMUST00000030530
SMART Domains Protein: ENSMUSP00000030530
Gene: ENSMUSG00000028750

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 143 1.83e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105808
SMART Domains Protein: ENSMUSP00000101434
Gene: ENSMUSG00000028750

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 143 1.83e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105809
AA Change: D133E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101435
Gene: ENSMUSG00000043621
AA Change: D133E

DomainStartEndE-ValueType
low complexity region 60 77 N/A INTRINSIC
UBX 188 270 5.36e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105810
AA Change: D133E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101436
Gene: ENSMUSG00000043621
AA Change: D133E

DomainStartEndE-ValueType
low complexity region 60 77 N/A INTRINSIC
UBX 188 270 5.36e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105811
AA Change: D133E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101437
Gene: ENSMUSG00000043621
AA Change: D133E

DomainStartEndE-ValueType
low complexity region 60 77 N/A INTRINSIC
UBX 188 270 5.36e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124660
SMART Domains Protein: ENSMUSP00000124341
Gene: ENSMUSG00000028750

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 128 1.4e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146415
AA Change: D133E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000117219
Gene: ENSMUSG00000043621
AA Change: D133E

DomainStartEndE-ValueType
low complexity region 60 77 N/A INTRINSIC
UBX 188 270 5.36e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Ubxn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02149:Ubxn10 APN 4 138721273 missense probably benign 0.00
IGL03216:Ubxn10 APN 4 138720739 missense probably damaging 1.00
PIT1430001:Ubxn10 UTSW 4 138720888 missense probably benign 0.01
R0885:Ubxn10 UTSW 4 138720570 missense probably damaging 1.00
R2031:Ubxn10 UTSW 4 138721263 missense possibly damaging 0.92
R4461:Ubxn10 UTSW 4 138720876 missense probably benign 0.31
R4737:Ubxn10 UTSW 4 138735948 intron probably benign
R4804:Ubxn10 UTSW 4 138721204 missense possibly damaging 0.71
R5739:Ubxn10 UTSW 4 138720823 missense probably benign 0.01
R6524:Ubxn10 UTSW 4 138720883 nonsense probably null
R7252:Ubxn10 UTSW 4 138720876 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAGCGCACGAACCTTTGGC -3'
(R):5'- AACCAGAAACCAGGAGTCTG -3'

Sequencing Primer
(F):5'- ACGAACCTTTGGCCTGAG -3'
(R):5'- AGTCTGTGCAACGGTCTCAAC -3'
Posted On2015-05-14