Incidental Mutation 'R4117:Vmn2r42'
ID315130
Institutional Source Beutler Lab
Gene Symbol Vmn2r42
Ensembl Gene ENSMUSG00000070844
Gene Namevomeronasal 2, receptor 42
SynonymsV2r4
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4117 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location8183265-8200320 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8194840 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 260 (Y260C)
Ref Sequence ENSEMBL: ENSMUSP00000119761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086282] [ENSMUST00000142934] [ENSMUST00000146278]
Predicted Effect probably damaging
Transcript: ENSMUST00000086282
AA Change: Y260C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083463
Gene: ENSMUSG00000070844
AA Change: Y260C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 59 71 N/A INTRINSIC
Pfam:ANF_receptor 73 470 1.6e-33 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.8e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136957
Predicted Effect probably damaging
Transcript: ENSMUST00000142934
AA Change: Y260C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123451
Gene: ENSMUSG00000070844
AA Change: Y260C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 59 71 N/A INTRINSIC
Pfam:ANF_receptor 73 469 7.4e-34 PFAM
Pfam:NCD3G 512 563 4.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146278
AA Change: Y260C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119761
Gene: ENSMUSG00000070844
AA Change: Y260C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 59 71 N/A INTRINSIC
Pfam:ANF_receptor 73 469 1.9e-33 PFAM
Pfam:NCD3G 512 565 6.7e-17 PFAM
Pfam:7tm_3 548 784 2e-78 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Vmn2r42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02444:Vmn2r42 APN 7 8184313 missense probably damaging 0.99
IGL02793:Vmn2r42 APN 7 8194853 missense probably benign 0.00
IGL02875:Vmn2r42 APN 7 8194853 missense probably benign 0.00
R1743:Vmn2r42 UTSW 7 8184265 missense probably benign 0.06
R3943:Vmn2r42 UTSW 7 8194780 missense possibly damaging 0.93
R4760:Vmn2r42 UTSW 7 8184277 missense probably damaging 1.00
R5233:Vmn2r42 UTSW 7 8194838 nonsense probably null
R6245:Vmn2r42 UTSW 7 8192734 missense probably damaging 1.00
R6683:Vmn2r42 UTSW 7 8184225 missense probably damaging 0.98
R6709:Vmn2r42 UTSW 7 8192619 missense probably benign 0.09
R7396:Vmn2r42 UTSW 7 8192642 missense probably benign 0.00
R7450:Vmn2r42 UTSW 7 8184221 missense probably benign 0.00
R7583:Vmn2r42 UTSW 7 8194741 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGAAATCTCACCATGGTGG -3'
(R):5'- TGGCAATGGTCTCCTTCATAC -3'

Sequencing Primer
(F):5'- GTGATCCATAGAATGTGTCATGAC -3'
(R):5'- CCTTGTCATCCCAGATGAT -3'
Posted On2015-05-14