Incidental Mutation 'R4117:Zfp607b'
ID315131
Institutional Source Beutler Lab
Gene Symbol Zfp607b
Ensembl Gene ENSMUSG00000057093
Gene Namezinc finger protein 607B
SynonymsC030039L03Rik
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27689340-27706484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27698682 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 64 (I64V)
Ref Sequence ENSEMBL: ENSMUSP00000112494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076421] [ENSMUST00000120004]
Predicted Effect probably damaging
Transcript: ENSMUST00000076421
AA Change: I64V

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075755
Gene: ENSMUSG00000057093
AA Change: I64V

DomainStartEndE-ValueType
KRAB 14 75 1.29e-35 SMART
ZnF_C2H2 172 194 1.08e-1 SMART
ZnF_C2H2 200 222 4.24e-4 SMART
ZnF_C2H2 228 250 2.2e-2 SMART
ZnF_C2H2 256 278 1.69e-3 SMART
ZnF_C2H2 284 306 4.94e-5 SMART
ZnF_C2H2 312 334 2.36e-2 SMART
ZnF_C2H2 339 361 1.18e-2 SMART
ZnF_C2H2 367 389 1.67e-2 SMART
ZnF_C2H2 395 417 1.38e-3 SMART
ZnF_C2H2 423 445 1.06e-4 SMART
ZnF_C2H2 451 473 1.67e-2 SMART
ZnF_C2H2 479 501 6.67e-2 SMART
ZnF_C2H2 507 529 3.52e-1 SMART
ZnF_C2H2 535 557 3.49e-5 SMART
ZnF_C2H2 563 585 1.56e-2 SMART
ZnF_C2H2 591 613 3.89e-3 SMART
ZnF_C2H2 619 641 9.73e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120004
AA Change: I64V

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112494
Gene: ENSMUSG00000057093
AA Change: I64V

DomainStartEndE-ValueType
KRAB 14 75 1.29e-35 SMART
ZnF_C2H2 172 194 1.08e-1 SMART
ZnF_C2H2 200 222 4.24e-4 SMART
ZnF_C2H2 228 250 2.2e-2 SMART
ZnF_C2H2 256 278 1.69e-3 SMART
ZnF_C2H2 284 306 4.94e-5 SMART
ZnF_C2H2 312 334 2.36e-2 SMART
ZnF_C2H2 339 361 1.18e-2 SMART
ZnF_C2H2 367 389 1.67e-2 SMART
ZnF_C2H2 395 417 1.38e-3 SMART
ZnF_C2H2 423 445 1.06e-4 SMART
ZnF_C2H2 451 473 1.67e-2 SMART
ZnF_C2H2 479 501 6.67e-2 SMART
ZnF_C2H2 507 529 3.52e-1 SMART
ZnF_C2H2 535 557 3.49e-5 SMART
ZnF_C2H2 563 585 1.56e-2 SMART
ZnF_C2H2 591 613 3.89e-3 SMART
ZnF_C2H2 619 641 9.73e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127200
Meta Mutation Damage Score 0.3674 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Other mutations in Zfp607b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Zfp607b APN 7 27698715 missense possibly damaging 0.75
IGL02114:Zfp607b APN 7 27703725 missense probably benign 0.19
IGL03171:Zfp607b APN 7 27693595 missense possibly damaging 0.70
IGL03329:Zfp607b APN 7 27703870 missense probably damaging 1.00
R0988:Zfp607b UTSW 7 27702976 missense probably benign 0.34
R1518:Zfp607b UTSW 7 27698662 missense possibly damaging 0.95
R1672:Zfp607b UTSW 7 27692523 missense possibly damaging 0.86
R1733:Zfp607b UTSW 7 27692524 missense possibly damaging 0.66
R1992:Zfp607b UTSW 7 27702524 missense possibly damaging 0.87
R2849:Zfp607b UTSW 7 27702394 missense probably benign 0.00
R3879:Zfp607b UTSW 7 27704051 missense possibly damaging 0.91
R4439:Zfp607b UTSW 7 27702724 missense probably damaging 1.00
R4610:Zfp607b UTSW 7 27703695 missense probably damaging 1.00
R4755:Zfp607b UTSW 7 27703505 missense probably damaging 1.00
R4909:Zfp607b UTSW 7 27703796 missense probably benign
R5095:Zfp607b UTSW 7 27693636 intron probably benign
R5301:Zfp607b UTSW 7 27703747 missense probably benign
R5422:Zfp607b UTSW 7 27702388 missense probably benign 0.00
R5538:Zfp607b UTSW 7 27702869 missense probably damaging 1.00
R5546:Zfp607b UTSW 7 27702607 missense probably benign 0.19
R5644:Zfp607b UTSW 7 27703769 missense probably damaging 1.00
R5649:Zfp607b UTSW 7 27703981 missense probably damaging 1.00
R5692:Zfp607b UTSW 7 27703464 missense probably benign 0.17
R5945:Zfp607b UTSW 7 27702416 missense probably benign 0.06
R6695:Zfp607b UTSW 7 27704039 missense probably benign 0.04
R7402:Zfp607b UTSW 7 27693494 missense probably damaging 1.00
R7515:Zfp607b UTSW 7 27703496 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGGGTCATGGTCAAGTACAC -3'
(R):5'- GTCACTTCTGCTGAAACCGTC -3'

Sequencing Primer
(F):5'- ATTAAAGTGGACTGCTACCTGGC -3'
(R):5'- GTCAAGAACTCTGAGAGCTCTGC -3'
Posted On2015-05-14