Incidental Mutation 'R4117:Plekhg2'
ID315132
Institutional Source Beutler Lab
Gene Symbol Plekhg2
Ensembl Gene ENSMUSG00000037552
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 2
SynonymsClg
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28359604-28372599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28360888 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1005 (H1005Q)
Ref Sequence ENSEMBL: ENSMUSP00000113449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094644] [ENSMUST00000119990] [ENSMUST00000121085] [ENSMUST00000144700]
Predicted Effect probably benign
Transcript: ENSMUST00000094644
AA Change: H981Q

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000092228
Gene: ENSMUSG00000037552
AA Change: H981Q

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 73 88 N/A INTRINSIC
RhoGEF 103 279 3.98e-49 SMART
PH 305 410 3.01e-8 SMART
low complexity region 463 481 N/A INTRINSIC
low complexity region 582 605 N/A INTRINSIC
low complexity region 842 856 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
low complexity region 1268 1292 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119990
AA Change: H980Q

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112881
Gene: ENSMUSG00000037552
AA Change: H980Q

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
RhoGEF 102 278 3.98e-49 SMART
PH 304 409 3.01e-8 SMART
low complexity region 462 480 N/A INTRINSIC
low complexity region 581 604 N/A INTRINSIC
low complexity region 841 855 N/A INTRINSIC
low complexity region 1231 1245 N/A INTRINSIC
low complexity region 1267 1291 N/A INTRINSIC
low complexity region 1319 1333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121085
AA Change: H1005Q

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113449
Gene: ENSMUSG00000037552
AA Change: H1005Q

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
RhoGEF 102 278 3.98e-49 SMART
PH 304 409 3.01e-8 SMART
low complexity region 462 479 N/A INTRINSIC
low complexity region 606 629 N/A INTRINSIC
low complexity region 866 880 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
low complexity region 1292 1316 N/A INTRINSIC
low complexity region 1344 1358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129145
Predicted Effect probably benign
Transcript: ENSMUST00000144700
SMART Domains Protein: ENSMUSP00000115651
Gene: ENSMUSG00000037552

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
RhoGEF 102 278 3.98e-49 SMART
PH 304 409 3.01e-8 SMART
low complexity region 462 480 N/A INTRINSIC
low complexity region 581 604 N/A INTRINSIC
low complexity region 841 855 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147767
Meta Mutation Damage Score 0.0617 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Plekhg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Plekhg2 APN 7 28360869 nonsense probably null
IGL00933:Plekhg2 APN 7 28360689 missense probably benign 0.01
IGL02037:Plekhg2 APN 7 28368697 missense probably damaging 1.00
IGL02103:Plekhg2 APN 7 28360076 missense probably damaging 1.00
IGL02598:Plekhg2 APN 7 28360475 missense possibly damaging 0.55
IGL02892:Plekhg2 APN 7 28362917 missense probably damaging 1.00
IGL03249:Plekhg2 APN 7 28368002 missense probably damaging 1.00
R0561:Plekhg2 UTSW 7 28370483 missense probably benign
R1134:Plekhg2 UTSW 7 28362001 missense probably damaging 0.99
R1619:Plekhg2 UTSW 7 28368421 missense probably damaging 1.00
R2225:Plekhg2 UTSW 7 28360335 missense probably benign 0.02
R4043:Plekhg2 UTSW 7 28364719 unclassified probably benign
R4296:Plekhg2 UTSW 7 28371166 missense probably damaging 1.00
R4956:Plekhg2 UTSW 7 28368355 missense probably damaging 1.00
R5376:Plekhg2 UTSW 7 28362669 missense probably damaging 0.99
R5378:Plekhg2 UTSW 7 28362669 missense probably damaging 0.99
R5523:Plekhg2 UTSW 7 28370431 missense probably damaging 1.00
R5545:Plekhg2 UTSW 7 28362461 missense probably damaging 1.00
R5667:Plekhg2 UTSW 7 28367639 missense probably damaging 1.00
R5913:Plekhg2 UTSW 7 28364602 missense probably damaging 0.99
R6017:Plekhg2 UTSW 7 28362884 missense probably damaging 0.97
R6088:Plekhg2 UTSW 7 28361013 missense probably benign 0.01
R6912:Plekhg2 UTSW 7 28360259 missense probably benign 0.39
R7258:Plekhg2 UTSW 7 28364778 missense probably benign 0.00
R7530:Plekhg2 UTSW 7 28361928 missense probably damaging 1.00
R8054:Plekhg2 UTSW 7 28365316 missense probably damaging 0.96
R8217:Plekhg2 UTSW 7 28368292 missense probably null 1.00
RF051:Plekhg2 UTSW 7 28362352 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTTGTGCACACTGGCAAAG -3'
(R):5'- GTAGTAACTCCATTCCACCGCC -3'

Sequencing Primer
(F):5'- CACACTGGCAAAGGGCTGAC -3'
(R):5'- CTGTCCCTTTACCTGGGCAAAG -3'
Posted On2015-05-14