Incidental Mutation 'R4117:Olfr561'
ID315133
Institutional Source Beutler Lab
Gene Symbol Olfr561
Ensembl Gene ENSMUSG00000073966
Gene Nameolfactory receptor 561
SynonymsMOR14-2, GA_x6K02T2PBJ9-5491151-5492095
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102771221-102776857 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 102774477 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098217] [ENSMUST00000213432] [ENSMUST00000213432]
Predicted Effect probably null
Transcript: ENSMUST00000098217
SMART Domains Protein: ENSMUSP00000095819
Gene: ENSMUSG00000073966

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 5.1e-122 PFAM
Pfam:7TM_GPCR_Srsx 37 259 9.6e-8 PFAM
Pfam:7tm_1 43 294 4.4e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213432
Predicted Effect probably null
Transcript: ENSMUST00000213432
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Olfr561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Olfr561 APN 7 102774907 missense probably damaging 0.99
IGL02743:Olfr561 APN 7 102775298 missense probably damaging 0.99
IGL03001:Olfr561 APN 7 102775253 missense probably damaging 0.98
R0254:Olfr561 UTSW 7 102774869 nonsense probably null
R0356:Olfr561 UTSW 7 102775079 missense probably damaging 1.00
R0514:Olfr561 UTSW 7 102775332 missense probably benign 0.00
R0725:Olfr561 UTSW 7 102774532 missense probably benign
R0739:Olfr561 UTSW 7 102774665 missense probably damaging 1.00
R1900:Olfr561 UTSW 7 102775331 missense probably benign 0.19
R2080:Olfr561 UTSW 7 102775243 missense probably benign 0.02
R2212:Olfr561 UTSW 7 102774755 missense possibly damaging 0.77
R2379:Olfr561 UTSW 7 102774845 missense probably benign 0.33
R3412:Olfr561 UTSW 7 102774755 missense possibly damaging 0.77
R3834:Olfr561 UTSW 7 102775286 missense probably damaging 1.00
R4363:Olfr561 UTSW 7 102775256 missense probably benign 0.34
R4401:Olfr561 UTSW 7 102774799 nonsense probably null
R5176:Olfr561 UTSW 7 102775306 missense probably damaging 0.99
R5464:Olfr561 UTSW 7 102775433 missense probably benign 0.00
R5465:Olfr561 UTSW 7 102775433 missense probably benign 0.00
R5493:Olfr561 UTSW 7 102775108 missense probably benign 0.00
R5540:Olfr561 UTSW 7 102774929 missense probably benign 0.02
R5629:Olfr561 UTSW 7 102774640 missense possibly damaging 0.63
R6227:Olfr561 UTSW 7 102774676 missense probably damaging 0.98
R6367:Olfr561 UTSW 7 102774829 missense possibly damaging 0.92
R6497:Olfr561 UTSW 7 102775450 missense probably benign 0.00
R7219:Olfr561 UTSW 7 102781706 missense probably benign 0.00
R7243:Olfr561 UTSW 7 102781658 missense probably benign
R7289:Olfr561 UTSW 7 102775427 missense probably damaging 1.00
R7560:Olfr561 UTSW 7 102781682 missense probably damaging 1.00
R7731:Olfr561 UTSW 7 102774934 missense probably benign 0.05
R8025:Olfr561 UTSW 7 102775256 missense probably benign 0.34
R8222:Olfr561 UTSW 7 102774892 missense probably damaging 1.00
R8304:Olfr561 UTSW 7 102774710 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- ATATAGATCTGAAGGCTTGGGTGTC -3'
(R):5'- TTCATGGAGGCTTGACTCAGTG -3'

Sequencing Primer
(F):5'- AGATCTGAAGGCTTGGGTGTCTTTAC -3'
(R):5'- AAGAGGATCATGCTGTTCCC -3'
Posted On2015-05-14