Incidental Mutation 'R4117:Zfp143'
ID315134
Institutional Source Beutler Lab
Gene Symbol Zfp143
Ensembl Gene ENSMUSG00000061079
Gene Namezinc finger protein 143
SynonymsD7Ertd805e, KRAB14, pHZ-1, Staf, Zfp79, Zfp80-rs1
MMRRC Submission 040991-MU
Accession Numbers

NCBI RefSeq: NM_009281.3; MGI:1277969

Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location110061217-110095394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110091913 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 557 (T557I)
Ref Sequence ENSEMBL: ENSMUSP00000148235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084727] [ENSMUST00000169638] [ENSMUST00000209505] [ENSMUST00000211798]
Predicted Effect probably damaging
Transcript: ENSMUST00000084727
AA Change: T558I

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081778
Gene: ENSMUSG00000061079
AA Change: T558I

DomainStartEndE-ValueType
ZnF_C2H2 236 260 5.5e-3 SMART
ZnF_C2H2 266 290 6.42e-4 SMART
ZnF_C2H2 296 320 4.01e-5 SMART
ZnF_C2H2 326 350 1.38e-3 SMART
ZnF_C2H2 356 380 3.95e-4 SMART
ZnF_C2H2 386 410 2.4e-3 SMART
ZnF_C2H2 416 439 1.79e-2 SMART
low complexity region 443 457 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169638
AA Change: T530I

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126015
Gene: ENSMUSG00000061079
AA Change: T530I

DomainStartEndE-ValueType
ZnF_C2H2 209 233 5.5e-3 SMART
ZnF_C2H2 239 263 6.42e-4 SMART
ZnF_C2H2 269 293 4.01e-5 SMART
ZnF_C2H2 299 323 1.38e-3 SMART
ZnF_C2H2 329 353 3.95e-4 SMART
ZnF_C2H2 359 383 2.4e-3 SMART
ZnF_C2H2 389 412 1.79e-2 SMART
low complexity region 416 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209252
Predicted Effect probably damaging
Transcript: ENSMUST00000209505
AA Change: T557I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000211798
AA Change: T557I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.2787 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
MGI Phenotype Strain: 2678408
PHENOTYPE: Homozygous disruption of this locus results in fertility defects. [provided by MGI curators]
Allele List at MGI

All alleles(86) : Targeted(2) Gene trapped(84)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Zfp143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Zfp143 APN 7 110091772 missense probably damaging 0.99
IGL01610:Zfp143 APN 7 110074126 nonsense probably null
IGL01678:Zfp143 APN 7 110080351 splice site probably benign
IGL01734:Zfp143 APN 7 110072209 splice site probably benign
IGL02505:Zfp143 APN 7 110091786 missense possibly damaging 0.54
IGL02577:Zfp143 APN 7 110091907 missense probably damaging 1.00
IGL03084:Zfp143 APN 7 110069611 splice site probably benign
H8786:Zfp143 UTSW 7 110094368 missense probably damaging 1.00
P0015:Zfp143 UTSW 7 110086111 critical splice acceptor site probably null
R0324:Zfp143 UTSW 7 110077147 missense possibly damaging 0.94
R0445:Zfp143 UTSW 7 110061117 unclassified probably benign
R0668:Zfp143 UTSW 7 110061274 unclassified probably benign
R1178:Zfp143 UTSW 7 110075721 splice site probably benign
R1587:Zfp143 UTSW 7 110074068 missense probably benign 0.06
R1992:Zfp143 UTSW 7 110061282 unclassified probably benign
R2110:Zfp143 UTSW 7 110086246 missense probably damaging 1.00
R2364:Zfp143 UTSW 7 110083242 missense probably damaging 0.97
R2417:Zfp143 UTSW 7 110069596 missense possibly damaging 0.73
R2899:Zfp143 UTSW 7 110072129 missense probably damaging 1.00
R3923:Zfp143 UTSW 7 110074191 missense probably damaging 1.00
R4804:Zfp143 UTSW 7 110088769 missense probably damaging 1.00
R5048:Zfp143 UTSW 7 110074118 missense probably damaging 0.99
R5097:Zfp143 UTSW 7 110088791 missense probably damaging 1.00
R5239:Zfp143 UTSW 7 110094352 missense probably damaging 1.00
R5541:Zfp143 UTSW 7 110070480 missense probably benign 0.02
R5543:Zfp143 UTSW 7 110083315 nonsense probably null
R5630:Zfp143 UTSW 7 110088773 missense probably damaging 1.00
R5806:Zfp143 UTSW 7 110086235 nonsense probably null
R6334:Zfp143 UTSW 7 110086131 missense probably damaging 1.00
R6736:Zfp143 UTSW 7 110091814 missense probably damaging 1.00
R7201:Zfp143 UTSW 7 110093080 missense possibly damaging 0.74
R7448:Zfp143 UTSW 7 110070498 missense probably benign 0.00
R7635:Zfp143 UTSW 7 110088818 missense probably benign 0.37
R7717:Zfp143 UTSW 7 110086220 missense possibly damaging 0.93
R8191:Zfp143 UTSW 7 110077157 missense probably damaging 1.00
R8268:Zfp143 UTSW 7 110091784 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GCTCTGTCCTTAGTTAAGATTGC -3'
(R):5'- ATATGCTATATATTTGTGGGTGCCC -3'

Sequencing Primer
(F):5'- CTGTCCTTAGTTAAGATTGCCAAATG -3'
(R):5'- CTGGATTACAGGCAGTTGTAAC -3'
Posted On2015-05-14