Incidental Mutation 'R4117:Cenpt'
ID315136
Institutional Source Beutler Lab
Gene Symbol Cenpt
Ensembl Gene ENSMUSG00000036672
Gene Namecentromere protein T
Synonyms
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105844673-105853278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105849700 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 73 (S73L)
Ref Sequence ENSEMBL: ENSMUSP00000038188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040776] [ENSMUST00000212431] [ENSMUST00000212552] [ENSMUST00000212839]
Predicted Effect probably benign
Transcript: ENSMUST00000040776
AA Change: S73L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038188
Gene: ENSMUSG00000036672
AA Change: S73L

DomainStartEndE-ValueType
Pfam:CENP-T_N 1 374 4.2e-174 PFAM
Pfam:CENP-T_C 404 507 5.4e-36 PFAM
Pfam:CENP-S 424 479 3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212357
Predicted Effect probably benign
Transcript: ENSMUST00000212431
Predicted Effect probably benign
Transcript: ENSMUST00000212552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212803
Predicted Effect probably benign
Transcript: ENSMUST00000212839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212873
Meta Mutation Damage Score 0.0725 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). CENPT is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Cenpt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Cenpt APN 8 105846665 missense possibly damaging 0.52
IGL01970:Cenpt APN 8 105845116 missense probably damaging 1.00
IGL03141:Cenpt APN 8 105851941 missense probably damaging 0.99
IGL03403:Cenpt APN 8 105849665 nonsense probably null
R0089:Cenpt UTSW 8 105846368 missense probably benign 0.00
R0508:Cenpt UTSW 8 105849515 missense possibly damaging 0.81
R0648:Cenpt UTSW 8 105844960 missense probably damaging 0.99
R1460:Cenpt UTSW 8 105848888 missense probably damaging 1.00
R1839:Cenpt UTSW 8 105849014 missense possibly damaging 0.95
R4732:Cenpt UTSW 8 105847136 missense probably benign 0.00
R4733:Cenpt UTSW 8 105847136 missense probably benign 0.00
R6246:Cenpt UTSW 8 105849259 missense possibly damaging 0.95
R6413:Cenpt UTSW 8 105846341 missense possibly damaging 0.64
R6582:Cenpt UTSW 8 105849201 nonsense probably null
R7299:Cenpt UTSW 8 105849904 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATCACAGTGGACGATTCTGG -3'
(R):5'- CCATACTCTAACAGGCAGGG -3'

Sequencing Primer
(F):5'- CGATTCTGGGGCTATAGAATGAGC -3'
(R):5'- GTAGCCAAACAAAGACAAGTGCTAG -3'
Posted On2015-05-14