Incidental Mutation 'R4117:Icam5'
ID315139
Institutional Source Beutler Lab
Gene Symbol Icam5
Ensembl Gene ENSMUSG00000032174
Gene Nameintercellular adhesion molecule 5, telencephalin
SynonymsTlcn, TLN, Icam3, CD50
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21032073-21039036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21037590 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 746 (V746E)
Ref Sequence ENSEMBL: ENSMUSP00000019616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019616]
Predicted Effect probably damaging
Transcript: ENSMUST00000019616
AA Change: V746E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019616
Gene: ENSMUSG00000032174
AA Change: V746E

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
Pfam:ICAM_N 32 122 1.5e-17 PFAM
Pfam:Ig_3 121 202 5.6e-4 PFAM
low complexity region 284 292 N/A INTRINSIC
IG_like 329 405 1.45e1 SMART
IG 416 488 1.72e-2 SMART
IG 499 569 5.84e-5 SMART
IG_like 580 662 3.57e1 SMART
IG 673 742 3.49e-3 SMART
IGc2 758 819 1.97e-11 SMART
transmembrane domain 833 855 N/A INTRINSIC
low complexity region 884 902 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180870
Meta Mutation Damage Score 0.4419 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein is expressed on the surface of telencephalic neurons and displays two types of adhesion activity, homophilic binding between neurons and heterophilic binding between neurons and leukocytes. It may be a critical component in neuron-microglial cell interactions in the course of normal development or as part of neurodegenerative diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit enhanced long-term potentiation, sensorimotor gating, and reward-based learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Icam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Icam5 APN 9 21036795 critical splice donor site probably null
IGL00972:Icam5 APN 9 21034697 missense probably damaging 0.99
IGL01690:Icam5 APN 9 21034799 missense possibly damaging 0.69
IGL02334:Icam5 APN 9 21035209 missense possibly damaging 0.92
IGL03387:Icam5 APN 9 21033801 missense probably benign 0.10
H8562:Icam5 UTSW 9 21035146 missense probably benign 0.04
R0002:Icam5 UTSW 9 21033505 missense probably benign 0.00
R0594:Icam5 UTSW 9 21035598 missense probably benign 0.11
R0605:Icam5 UTSW 9 21032197 missense probably benign 0.23
R1485:Icam5 UTSW 9 21036406 missense probably benign 0.34
R1773:Icam5 UTSW 9 21033525 missense possibly damaging 0.67
R1934:Icam5 UTSW 9 21034786 missense probably benign 0.32
R3125:Icam5 UTSW 9 21036658 missense probably benign 0.00
R4132:Icam5 UTSW 9 21036657 missense probably benign
R4250:Icam5 UTSW 9 21037739 missense probably damaging 0.98
R4470:Icam5 UTSW 9 21035506 nonsense probably null
R4471:Icam5 UTSW 9 21035506 nonsense probably null
R4826:Icam5 UTSW 9 21037803 missense possibly damaging 0.67
R5182:Icam5 UTSW 9 21034810 missense probably benign
R5586:Icam5 UTSW 9 21034820 missense probably damaging 0.98
R6200:Icam5 UTSW 9 21038749 missense probably damaging 1.00
R6240:Icam5 UTSW 9 21033158 missense possibly damaging 0.80
R6291:Icam5 UTSW 9 21036921 missense probably benign 0.07
R7229:Icam5 UTSW 9 21037001 missense possibly damaging 0.79
R7395:Icam5 UTSW 9 21035442 missense possibly damaging 0.77
R7414:Icam5 UTSW 9 21037593 missense probably damaging 0.98
R7423:Icam5 UTSW 9 21036905 missense probably benign
R8032:Icam5 UTSW 9 21033218 missense probably benign 0.35
R8286:Icam5 UTSW 9 21035526 missense possibly damaging 0.71
Z1177:Icam5 UTSW 9 21035548 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGACTTCTCTGAATCCCCAGC -3'
(R):5'- GTCGCTGCACACTCATACTC -3'

Sequencing Primer
(F):5'- GCCCCAACCATCTCAGTAAG -3'
(R):5'- ACTCATACTCGCCGCCATGG -3'
Posted On2015-05-14