Incidental Mutation 'R4117:4930444G20Rik'
ID315140
Institutional Source Beutler Lab
Gene Symbol 4930444G20Rik
Ensembl Gene ENSMUSG00000069712
Gene NameRIKEN cDNA 4930444G20 gene
Synonyms
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location22066307-22068079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22067716 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 122 (N122Y)
Ref Sequence ENSEMBL: ENSMUSP00000097613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092672]
Predicted Effect probably benign
Transcript: ENSMUST00000092672
AA Change: N122Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097613
Gene: ENSMUSG00000069712
AA Change: N122Y

DomainStartEndE-ValueType
low complexity region 194 205 N/A INTRINSIC
Pfam:Peptidase_C48 315 494 1.9e-45 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Ctdnep1 C A 11: 69,988,671 A7D probably damaging Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in 4930444G20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02001:4930444G20Rik APN 10 22067277 missense probably benign 0.01
IGL02546:4930444G20Rik APN 10 22066927 missense probably damaging 1.00
IGL02885:4930444G20Rik APN 10 22067158 missense possibly damaging 0.94
R0543:4930444G20Rik UTSW 10 22066924 missense possibly damaging 0.88
R1762:4930444G20Rik UTSW 10 22067512 missense probably benign 0.02
R2249:4930444G20Rik UTSW 10 22067116 missense possibly damaging 0.77
R2354:4930444G20Rik UTSW 10 22067256 missense probably benign 0.19
R2870:4930444G20Rik UTSW 10 22067379 missense probably benign
R2870:4930444G20Rik UTSW 10 22067379 missense probably benign
R3777:4930444G20Rik UTSW 10 22066962 missense probably damaging 1.00
R4644:4930444G20Rik UTSW 10 22066761 missense probably benign 0.02
R5002:4930444G20Rik UTSW 10 22067817 missense probably damaging 0.99
R5667:4930444G20Rik UTSW 10 22066843 missense possibly damaging 0.91
R5671:4930444G20Rik UTSW 10 22066843 missense possibly damaging 0.91
R6694:4930444G20Rik UTSW 10 22067721 missense probably damaging 0.99
R6810:4930444G20Rik UTSW 10 22066717 missense probably damaging 1.00
R6923:4930444G20Rik UTSW 10 22067755 missense probably damaging 1.00
R6942:4930444G20Rik UTSW 10 22067261 missense probably benign
R7065:4930444G20Rik UTSW 10 22067298 missense probably benign 0.00
R7204:4930444G20Rik UTSW 10 22067886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGATGGTTCTCGATCGCTC -3'
(R):5'- GGATGGTATTTAAAGAGCCTGGC -3'

Sequencing Primer
(F):5'- ATGGTTCTCGATCGCTCTGAGTTC -3'
(R):5'- GAGCCTCGAGATCAAGAGCTC -3'
Posted On2015-05-14