Incidental Mutation 'R4117:Ctdnep1'
ID315141
Institutional Source Beutler Lab
Gene Symbol Ctdnep1
Ensembl Gene ENSMUSG00000018559
Gene NameCTD nuclear envelope phosphatase 1
Synonyms2610507E10Rik, Dullard
MMRRC Submission 040991-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4117 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69981156-69990601 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69988671 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 7 (A7D)
Ref Sequence ENSEMBL: ENSMUSP00000137199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018711] [ENSMUST00000108592] [ENSMUST00000108593] [ENSMUST00000141623]
Predicted Effect probably benign
Transcript: ENSMUST00000018711
SMART Domains Protein: ENSMUSP00000018711
Gene: ENSMUSG00000018567

DomainStartEndE-ValueType
Pfam:Atg8 13 116 1.8e-51 PFAM
Pfam:APG12 30 116 6.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108592
SMART Domains Protein: ENSMUSP00000104233
Gene: ENSMUSG00000018567

DomainStartEndE-ValueType
Pfam:Atg8 13 93 5.4e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108593
AA Change: A140D

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104234
Gene: ENSMUSG00000018559
AA Change: A140D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
CPDc 60 212 7.35e-76 SMART
low complexity region 214 224 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139007
Predicted Effect probably damaging
Transcript: ENSMUST00000141623
AA Change: A7D

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137199
Gene: ENSMUSG00000018559
AA Change: A7D

DomainStartEndE-ValueType
CPDc 1 79 6.29e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152226
Meta Mutation Damage Score 0.6157 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (31/32)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality, abnormal extraembryonic tissue development, poorly developed head fold and trunk and severely reduced primordial germ cell numbers due to a failure to transit to mesoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,716 N122Y probably benign Het
Acss2 T C 2: 155,556,393 F358L probably damaging Het
Adamts16 A G 13: 70,767,992 Y775H probably benign Het
Bard1 A T 1: 71,046,763 H594Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cenpt G A 8: 105,849,700 S73L probably benign Het
Fam210b T C 2: 172,351,566 S100P probably benign Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm11127 T C 17: 36,057,604 D144G probably damaging Het
Gm11492 T C 11: 87,568,282 F494S probably damaging Het
Heph T C X: 96,500,615 V615A probably benign Het
Icam5 T A 9: 21,037,590 V746E probably damaging Het
Maml2 A G 9: 13,705,934 Q192R probably damaging Het
Npas4 T C 19: 4,987,363 Y301C probably damaging Het
Nup205 C T 6: 35,241,012 Q1767* probably null Het
Olfr561 T A 7: 102,774,477 probably null Het
Pigg A G 5: 108,348,042 R982G probably benign Het
Plekhg2 A T 7: 28,360,888 H1005Q probably benign Het
Rdh12 C T 12: 79,213,645 R172C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9 T A 13: 33,015,596 D291E probably benign Het
She A T 3: 89,852,372 Y394F probably damaging Het
Sipa1l2 T C 8: 125,468,510 S830G probably damaging Het
Stmn4 T C 14: 66,361,132 *217Q probably null Het
Stx17 A G 4: 48,180,689 D178G probably damaging Het
Tbc1d9 T G 8: 83,266,147 I960S possibly damaging Het
Ubxn10 G T 4: 138,720,965 D133E probably benign Het
Vmn2r42 T C 7: 8,194,840 Y260C probably damaging Het
Vmn2r7 A C 3: 64,715,717 probably benign Het
Zfp143 C T 7: 110,091,913 T557I probably damaging Het
Zfp607b A G 7: 27,698,682 I64V probably damaging Het
Other mutations in Ctdnep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03246:Ctdnep1 APN 11 69984330 unclassified probably benign
R0118:Ctdnep1 UTSW 11 69988731 critical splice donor site probably null
R1521:Ctdnep1 UTSW 11 69988635 missense probably damaging 1.00
R2980:Ctdnep1 UTSW 11 69988671 missense probably damaging 0.97
R3932:Ctdnep1 UTSW 11 69989574 unclassified probably benign
R5383:Ctdnep1 UTSW 11 69984396 unclassified probably benign
R5485:Ctdnep1 UTSW 11 69981490 missense possibly damaging 0.93
R5913:Ctdnep1 UTSW 11 69988865 missense probably damaging 1.00
R6214:Ctdnep1 UTSW 11 69989508 missense probably damaging 1.00
R6706:Ctdnep1 UTSW 11 69984312 missense probably benign
R7733:Ctdnep1 UTSW 11 69990009 missense probably damaging 1.00
R8312:Ctdnep1 UTSW 11 69988701 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCTGAGTCTCAAGGGCCTTC -3'
(R):5'- CCAAAGTGCAGTGCTGGAAAC -3'

Sequencing Primer
(F):5'- TTCCCCAGACACTGAGCG -3'
(R):5'- CAGAGGACTATGGAGCACACC -3'
Posted On2015-05-14